Unlock instant, AI-driven research and patent intelligence for your innovation.

A nano-multiplex PCR method for distinguishing four serotypes of avian adenovirus group I

An avian adenovirus and serotype technology, which is applied in biochemical equipment and methods, and the determination/inspection of microorganisms, which can solve the problems of tediousness, poor sensitivity, and the need for special instruments.

Active Publication Date: 2021-04-23
QINGDAO AGRI UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to overcome the defects in existing avian adenovirus group I typing methods, which are cumbersome, require special instruments, and have poor sensitivity, and seek to provide a fast, simple and accurate method for distinguishing four serotypes of avian adenoviruses. Group I nano-multiplex PCR method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nano-multiplex PCR method for distinguishing four serotypes of avian adenovirus group I
  • A nano-multiplex PCR method for distinguishing four serotypes of avian adenovirus group I
  • A nano-multiplex PCR method for distinguishing four serotypes of avian adenovirus group I

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Synthesis of nanometer multiplex PCR primers:

[0030] According to the 4, 8a, 8b and 11 types of avian adenovirus group I typing detection primer sequences designed in Table 1, synthesize various type-specific primers; 4 types of avian adenovirus group I primers (F: 5'-CAARTTCAGRCAGACGGT-3' R: 5'-AAGAGGCCCGGGCAATGC-3'); Type 8a avian adenovirus group I primer (F: 5'- CAARTTCAGRCAGACGGT -3' R: 5'-AATGTTTGACGAGCTGATGGG -3'); type 8b avian adenovirus group I primer (F : 5'- CAARTTCAGRCAGACGGT -3'R: 5'- ATGCTGCAGCTGTTGCCGTAG -3'); Type 11 avian adenovirus group I primer (F: 5'-CAARTTCAGRCAGACGGT-3' R: 5'- ACTGCCGTCGTCTCGTCTAAG -3');

[0031] 2. Extraction of genes:

[0032] Take 4, 8a, 8b and 11 types of avian adenovirus group I standard strains (purchased from the China Veterinary Drug Administration) cell grinding solution 400μL in a 1.5mLEP tube, add 400μL chloroform, 600μL lysate, mix well and precipitate at 4°C for 10min Afterwards, centrifuge at 12000r / min for 1...

Embodiment 2

[0042] Embodiment 2, nanometer multiplex PCR specificity test:

[0043] The cDNA of Infectious Bronchitis Virus (IBV), Egg Drop Syndrome Virus (EDSV), H9 Subtype Avian Influenza Virus (AIV-H9) and Newcastle Disease (NDV) were detected by the nano-multiplex PCR method established above. Validate the specificity of the method.

[0044] Such as image 3 As shown, M: 2000 maker, 1: four serotypes of avian adenovirus group I positive sample mixture, 2: IBV, 3: EDSV, 4: AIV-H9, 5: NDV.

[0045] No bands were amplified in the test results, and only the specific bands of the four serotypes of avian adenovirus-I group were amplified, indicating that the primers had good specificity.

Embodiment 3

[0046] Embodiment 3, sensitivity test:

[0047] The positive plasmid established by the hexon whole gene of the standard strain of avian adenovirus group I of type 4, 8a, 8b and 11 was used as a template, and the 10-fold serial dilution was performed to determine the minimum detection concentration of nanometer multiplex PCR and ordinary multiplex PCR.

[0048] Such as Figure 4 As shown, multiplex PCR concentration gradient: M: 2000maker, 1: original concentration plasmid, 2: 10×10 1 1-fold diluted plasmid, 3:10×10 2 1-fold diluted plasmid, 4:10×10 3 1-fold diluted plasmid, 5:10×10 4 1-fold diluted plasmid, 6:10×10 5 1-fold diluted plasmid, 7:10×10 6 Double diluted plasmid, 8:10×10 7 Dilute the plasmid one-fold. The minimum concentration of ordinary multiplex PCR detection is: FAdV-4 is 5.14×10 7 Copy·μL -1 , FAdV-8a is 2.87×10 7 Copy·μL -1 , FAdV-8b is 1.71×10 6 Copy·μL -1 , FAdV-11 is 4.35×10 7 Copy·μL -1 .

[0049] Such as Figure 5 As shown, the concentra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nanometer multiplex PCR method for distinguishing four serotypes of poultry adenovirus group I. According to the hexon gene sequences of type 4, 8a, 8b and 11 poultry adenovirus group I published by GenBank, various types of adenovirus specificity are designed and synthesized. Primers; after extracting the gene, conduct nanometer multiplex PCR amplification. The PCR reaction conditions are 95°C pre-denaturation for 5min, 94°C for 30s, 53°C for 1min, 72°C for 1min49s, 30 cycles; 72°C extension for 10min; nanometer multiplex PCR amplification reaction After the end, take the PCR product, use DL2000 as Maker, and run 1% agarose gel electrophoresis to observe the size of the amplified fragment and determine the serotype of the virus. The method of the present invention significantly shortens the detection time; adding nanoparticles, under the condition of simultaneously detecting four serotypes of viruses, the sensitivity is at least 10 times higher than that of common multiplex PCR; the specificity is strong, the sensitivity is high, the stability is good, and it can quickly , Sensitive and accurate typing of avian adenovirus group I which is the main serotype prevailing in my country.

Description

technical field [0001] The invention relates to a nanometer multiplex PCR method, in particular to a nanometer multiplex PCR method for distinguishing four serotypes of poultry adenovirus group I, and belongs to the technical field of animal virus detection. Background technique [0002] Fowl adenovirus (Fowl adenovirus, FAdV) group I mainly includes 12 serotypes. Changjing Li et al. (2016) sequenced and analyzed the Hexon gene of the isolated strain of fowl adenovirus group I in my country from 2006 to 2016, indicating that my country The main prevalent serotypes are 4, 8a, 8b and 11. The high infection rate and high mortality of avian adenovirus group I to broiler chickens have caused serious economic losses to the chicken industry. These four serotypes of avian adenoviruses all caused severe hepatic inflammation in broiler chickens, and the clinical symptoms caused by them were very similar, which brought difficulties to the clinical detection of different serotypes of avi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686
CPCC12Q1/686C12Q1/701C12Q2537/143C12Q2563/149
Inventor 王建琳江之瑶尹燕博王守春
Owner QINGDAO AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More