Atropa belladonna WRKY transcription factor gene and recombinant plant expression vector and application thereof
A technology for plant expression vectors and transcription factors, which can be used in the improvement of belladonna alkaloids. In the field of recombinant plant expression vectors, it can solve the problems of inability to achieve chemical total synthesis, unclear biosynthesis pathways of secondary metabolites, and high costs.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Embodiment 1, the cloning of belladonna AbWRKY1 gene
[0024] (1) Extraction of total RNA from belladonna fibrous roots
[0025] Take an appropriate amount of belladonna fibrous root tissue, grind it in liquid nitrogen, add it to a 1.5mL Eppendorf (EP) centrifuge tube filled with lysate, shake it fully, and extract total RNA according to the instructions of the TIANGEN kit. The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA concentration was determined on a spectrophotometer.
[0026] (2) Cloning of belladonna AbWRKY1 gene
[0027] Using the extracted total RNA as a template, cDNA was synthesized according to the instructions of the Tiangen FastKing cDNA First Strand Synthesis Kit; gene-specific primers were designed according to the sequence of the AbWRKY1 gene, and the specific primers were as follows:
[0028] AbWRKY1-F: 5'-atgcattataactcaacgtt-3' (SEQ ID NO.1);
[0029] AbWRKY1-R: 5'-ttagaatctagagagaaact-3' (SEQ ID...
Embodiment 2
[0032] Embodiment 2, the construction of the recombinant plant expression vector containing AbWRKY1 gene
[0033] In order to study the effect of AbWRKY1 gene on tropine alkaloids in belladonna, the overexpression vector pBI121-AbWRKY1 of AbWRKY1 was constructed. In the vector construction, the restriction site of BamH1 was introduced into the forward primer, and the restriction site of Sac1 was introduced into the reverse primer. The primers are shown in Table 1;
[0034] Table 1, pBI121-AbWRKY1 vector construction primer sequence
[0035] Primer name
Primer sequence (5'→3')
pBI121-AbWRKY1-F (SEQ ID NO.5)
cgcggatccatgcattataactcaacgtt
pBI121-AbWRKY1-R (SEQ ID NO.6)
cgcgagctcttagaatctagagagaaact
[0036] Then, using the correctly sequenced pMD19-T vector containing the AbWRKY1 gene as a template, and the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 as primers, KOD plus from TOYOBO Company was used for PCR amplification. The PCR amplif...
Embodiment 3
[0038] Example 3, Agrobacterium rhizogenes-mediated AbWRKY1 overcarrier genetic transformation of belladonna to obtain transgenic belladonna hairy roots
[0039] (1) Acquisition of Agrobacterium rhizogenes Engineering Bacteria Containing pBI121-AbWRKY1 Expression Vector
[0040] The pBI121-AbWRKY1 expression vector in Example 2 was transformed into Agrobacterium rhizogenes (such as C58C1) by the freeze-thaw method, and PCR verification was performed. The results showed that the pBI121-AbWRKY1 expression vector had been successfully constructed into the strain of Agrobacterium rhizogenes.
[0041] (2) Agrobacterium rhizogenes mediates AbWRKY1 gene transformation of belladonna
[0042] a. Belladonna explant preparation
[0043] Belladonna seeds were soaked in ethanol with a volume fraction of 75% for 1 min, then soaked with NaClO with a mass fraction of 50% for 20 min, rinsed with sterile water for 3-4 times, blotted the surface moisture with sterile absorbent paper, and inocu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


