Belladonna wrky transcription factor gene and its recombinant plant expression vector and application
A plant expression vector and transcription factor technology, applied in the field of improving the application of belladonna alkaloids and recombinant plant expression vector, can solve the problems of inability to achieve full chemical synthesis, high cost, and unclear biosynthetic pathways of secondary metabolites.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1. Cloning of the belladonna AbWRKY1 gene
[0024] (1) Extraction of total RNA from belladonna fibrous root
[0025] Take an appropriate amount of belladonna fibrous root tissue, grind it in liquid nitrogen, add it to a 1.5mL Eppendorf (EP) centrifuge tube containing lysis buffer, and after sufficient shaking, extract total RNA according to the instructions of the TIANGEN kit. The total NA mass was identified by formaldehyde denaturing gel electrophoresis, and the RNA concentration was determined on a spectrophotometer.
[0026] (2) Cloning of AbWRKY1 gene of belladonna
[0027] Using the extracted total RNA as a template, synthesize cDNA according to the instructions of Tiangen FastKing cDNA first-strand synthesis kit; design gene-specific primers according to the sequence of the AbWRKY1 gene, and the specific primers are as follows:
[0028] AbWRKY1-F: 5'-atgcattataactcaacgtt-3' (SEQ ID NO. 1);
[0029] AbWRKY1-R: 5'-ttagaatctagagagaaact-3' (SEQ ID NO. 2); ...
Embodiment 2
[0032] Example 2. Construction of recombinant plant expression vector containing AbWRKY1 gene
[0033] In order to study the effect of AbWRKY1 gene on tropane alkaloids in belladonna, the AbWRKY1 overexpression vector pBI121-AbWRKY1 was constructed. In the construction of the vector, the forward primer introduced the enzyme cleavage site of BamH1, and the reverse primer introduced the enzyme cleavage site of Sac1. The primers are shown in Table 1;
[0034] Table 1. Primer sequences for pBI121-AbWRKY1 vector construction
[0035] primer name
Primer sequence (5'→3')
pBI121-AbWRKY1-F (SEQ ID NO. 5)
cgcggatccatgcattataactcaacgtt
pBI121-AbWRKY1-R (SEQ ID NO. 6)
cgcgagctcttagaatctagagagaaact
[0036] Then, using the correctly sequenced pMD19-T vector containing the AbWRKY1 gene as a template, and the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 as primers, PCR amplification was carried out using KOD plus of TOYOBO Company, and the PCR ampli...
Embodiment 3
[0038] Example 3. Agrobacterium rhizogenes-mediated AbWRKY1 vector genetic transformation of belladonna to obtain transgenic belladonna hairy roots
[0039] (1) Obtainment of Agrobacterium rhizogenes engineering bacteria containing pBI121-AbWRKY1 expression vector
[0040] The pBI121-AbWRKY1 expression vector in Example 2 was transferred into Agrobacterium rhizogenes (such as C58C1) by freeze-thaw method, and verified by PCR. The results show that the pBI121-AbWRKY1 expression vector has been successfully constructed into the Agrobacterium rhizogenes strain.
[0041] (2) Agrobacterium rhizogenes-mediated transformation of belladonna with AbWRKY1 gene
[0042] a. Belladonna explant preparation
[0043] Belladonna seeds were soaked in ethanol with a volume fraction of 75% for 1 min, then soaked in NaClO with a mass fraction of 50% for 20 min, rinsed with sterile water for 3-4 times, dried with sterile absorbent paper, and inoculated in hormone-free 1 / 2MS (Murashige and Skoog,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

