A kind of pand mutant gene, genetic engineering and its application in catalytic production of β-alanine

A technology of mutant genes and genetically engineered bacteria, applied in genetic engineering and its application in the catalytic production of beta-alanine, in the field of panD mutant genes, can solve the problems of insufficient recombinant expression and activity, limiting the application of PanD, etc. Achieve high efficiency and clear breeding goals

Active Publication Date: 2020-11-27
NANJING TECH UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the patent CN 101210230A, the L-aspartic acid-α-alanine decarboxylase gene in Escherichia coli was cloned and expressed heterologously, but the ability to synthesize β-alanine only reached 2.94g / L, far from the real application still a long way
[0004] Although the recombinant expression of the panD gene has improved its ability in biological preparation of β-alanine to a certain extent, the recombinant expression and activity of the natural sequence and structure of panD are not high enough, which limits the use of PanD in biological methods. Application in preparation of β-alanine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of pand mutant gene, genetic engineering and its application in catalytic production of β-alanine
  • A kind of pand mutant gene, genetic engineering and its application in catalytic production of β-alanine
  • A kind of pand mutant gene, genetic engineering and its application in catalytic production of β-alanine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: This example compares the effects of panD genes from different sources on the production of β-alanine.

[0034] Construction of strains from three different gene sources:

[0035] Extract the genomic DNA of Escherichia coli Mg1655, C.glutamicum (ATCC13032), and Bacillus subtilis (in the laboratory) and use it as a template to amplify the L-aspartic acid-α-decarboxylase gene panD by PCR, and the PCR product is passed through After agarose gel electrophoresis identification, recovery, and purification, the fragment panD with NcoI and XhoI restriction sites was obtained, and the fragment was connected with the recombinant plasmid pET-28a treated with the same restriction endonuclease, using T4DNA ligase Connect at 25°C for 30min.

[0036] The above ligation solution was transferred to Escherichia coli Transl-T1 competent cells (Quanshijin Biotechnology Co., Ltd.), spread on LB plates with 50 mg / L kana resistance, and cultured overnight at 37°C.

[0037] Pick a s...

Embodiment 2

[0039] Example 2: Effect of metal ions on catalytic reactions.

[0040] Pick the recombinant strain E.coliBL21(DE3)-pET28a-panD C.g A single colony of 50mg / L kanamycin-resistant 5ML LB shake tube, cultured for 6-8h, transferred to 100ml LB containing 50mg / L kanamycin-resistant, to OD 600 =0.6, add 0.5mmol of IPTG, culture in a shaker at 30°C, and after 10h, centrifuge at 6000g for 5min. Add L-aspartic acid to the recombinant strain: 10g / L (adjust the pH to 7.0 with sodium hydroxide), add buffer Mops (pH6.0), 50mM Fe 2+ , 37°C, 200rpm, sampling after 12h, liquid phase detection of accumulation of L-aspartic acid and β-alanine, such as figure 2 shown.

Embodiment 3

[0041] Example 3: Construction of panD gene mutant library.

[0042] (1) Escherichia coli BL21(DE3) / pET28a(+)-panD obtained in Example 1 C.g Inoculate in LB liquid medium, culture in a shaker at 30°C, centrifuge at 6000g for 5min after 10h, collect bacterial cells, and extract plasmid pET28a with a plasmid extraction kit (purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.) (+)-panD; LB liquid medium consists of: peptone 10g / L, yeast powder 5g / L, sodium chloride 5g / L, kanamycin 50mg / L.

[0043] (2) The establishment of error-prone PCR reaction: (a) design the forward primer (C.g-panD-NcoI-F, catg CCATGG GCATGCTGCGCACCATCCTC, the underline is NcoI restriction site) and reverse primer (C.g-panD-XhoI-R: ccg CTCGAG CTAAATGCTTCTCGACGTCAAAAAGCC, the underline is the XhoI restriction site); (b) Prepare 50 μL of PCR reaction mixture, the system is: 10×Taq buffer: 5ul, Mn 2+ (50mmol / L): 3.5ul, Mg 2+ (25mmol / L): 14ul, DNA template: 10ul, 10×dNTP: 5ul, upstre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a panD mutant gene with a nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.3. According to SEQ ID No.1 of the panD mutant gene, the 34th base of the panD gene is transformed from A into G; according to SEQ ID No.3 of the panD mutant gene, the 50th base of the panD gene is transformed from T into C. The invention also discloses a genetically engineered bacterium comprising the mutant gene and application of the genetically engineered bacterium in catalytic production of beta-alanine. The genetically engineered bacterium comprising the panD mutant gene can efficiently transform L-aspartic acid to prepare the beta-alanine through a biological method; the yields of the beta-alanine reach about 42.81 g / L and 19.46 g / L respectively, which are increased by almost 4.8times and 2.2 times when being compared with the yield of the beta-alanine of a parent strain.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a panD mutant gene, genetic engineering and its application in catalytic production of beta-alanine. Background technique [0002] β-alanine, alias: 3-aminopropanoic acid (3-aminopropanoic acid), also known as β-alanine, β-serine, β-prime oil amino acid, as an important chemical, Widely used in cosmetics, water treatment, construction, feed, food, medicine and other fields. Such as: can be used as lead poisoning antidote. β-Alanine is also a potential platform compound, through chemical reaction, it can be derived a variety of important chemicals, such as: D-calcium pantothenate, nylon-3, acrylonitrile and so on. At present, the global annual output of D-calcium pantothenate is 6000-7000t, and the annual demand reaches tens of thousands of tons. The supply of products is in short supply. In the pharmaceutical industry, β-alanine is mainly used as the initial raw material to synthe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/60C12N9/88C12N15/70C12N1/21C12P13/06C12R1/19
CPCC12N9/88C12N15/70C12P13/06C12Y401/01011
Inventor陈可泉李欢欢王昕卢媛媛欧阳平凯
OwnerNANJING TECH UNIV