Application of lncRNA SGOL1-AS1 serving as marker for diagnosing stomach cancer
A technology for diagnosing markers and gastric cancer, applied in the application field of lncRNASGOL1-AS1 as a diagnostic marker for gastric cancer, can solve the problem of lncRNA that has not yet been found
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1 adopts RACE technology to obtain the full-length cDNA sequence of SGOL1-AS1
[0038] 1. Primer design
[0039] The cDNA sequence of the fragment of lncRNA SGOL1-AS1 is shown in SEQ ID NO: 2, and 5' RACE nested PCR primers and 3' RACE nested PCR primers were designed.
[0040] 5'RACE nested PCR first PCR primer, SEQ ID NO.3:
[0041] CCTTCCTGGAGTCCCTGAAAATGT;
[0042] 5'RACE nested PCR second PCR primer, SEQ ID NO.4:
[0043] TTCAGGAGATGATTCCGATGACC
[0044] 3'RACE nested PCR first PCR primer, SEQ ID NO.5:
[0045] TCCATTGGTTGGCTGGGAGGCGG;
[0046] 3' RACE Nested PCR Second PCR Primers. SEQ ID NO.6:
[0047] ACATTCGCTCAAGTCCACATCCG;
[0048] After experimental verification, the nested PCR primers can achieve the expected experimental purpose and specifically amplify the target fragment.
[0049] The total RNA of human SGC-7901 cells was routinely extracted by Trizol method. Then press Clontech RACE 5' / 3' kit (Cat. No. 634860) instruction manual for...
Embodiment 2
[0072] Embodiment 2 A kind of kit for the diagnosis of gastric cancer
[0073] 1. A kit for diagnosing gastric cancer, comprising a primer set for detecting gastric cancer, a positive quality control product and a primer for the internal reference gene GAPDH. Wherein, the sequence of the primer set used for gastric cancer detection is shown in SEQ ID NO: 7-8; the positive quality control product is a recombinant vector inserted into the cDNA sequence of lncRNA SGOL1-AS1 or a fragment thereof; the internal reference gene GAPDH primer is shown in SEQ ID NO: 9 ~10 shown. All other reagents used in this kit are commercially available.
[0074] 2. Detection method
[0075] (1) Extract sample RNA with Trizol, the specific steps are as follows:
[0076] (1) Add an appropriate amount of Trizol to the sample, and crack the sample for 15 minutes at room temperature.
[0077] (II) Add 0.2ml of chloroform to every milliliter of Trizol, shake and mix well, and let stand at room tempera...
Embodiment 4
[0109] Example 4 Detection of gastric cancer patients and healthy human platelet samples
[0110] 1. Whole blood was collected from 50 patients with gastric cancer and 45 healthy people. All patients and healthy people knew and agreed to the test.
[0111] 2. Platelet samples
[0112] Collect 5 mL of fresh blood on an empty stomach, store it in EDTA anticoagulant tubes, and keep it at room temperature for no more than 1 hour. Centrifuge at 150g room temperature for 10min, absorb the platelet-rich plasma in the upper layer, then centrifuge at 400g for 20min at room temperature, suck off the supernatant, and precipitate into platelets, add 30μl RNAlater to the platelets, overnight at 4, transfer to -80°C for long-term storage.
[0113] 3. The above samples were tested according to the method described in Example 2.
[0114] 4. Results: The expression of lncRNASGOL1-AS1 in platelets of patients with gastric cancer was significantly lower than that in platelets of healthy people...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



