Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of lncRNA SGOL1-AS1 serving as marker for diagnosing stomach cancer

A technology for diagnosing markers and gastric cancer, applied in the application field of lncRNASGOL1-AS1 as a diagnostic marker for gastric cancer, can solve the problem of lncRNA that has not yet been found

Active Publication Date: 2018-05-15
CANCER CENT OF GUANGZHOU MEDICAL UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no suitable lncRNA has been found as a cancer marker

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of lncRNA SGOL1-AS1 serving as marker for diagnosing stomach cancer
  • Application of lncRNA SGOL1-AS1 serving as marker for diagnosing stomach cancer
  • Application of lncRNA SGOL1-AS1 serving as marker for diagnosing stomach cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1 adopts RACE technology to obtain the full-length cDNA sequence of SGOL1-AS1

[0038] 1. Primer design

[0039] The cDNA sequence of the fragment of lncRNA SGOL1-AS1 is shown in SEQ ID NO: 2, and 5' RACE nested PCR primers and 3' RACE nested PCR primers were designed.

[0040] 5'RACE nested PCR first PCR primer, SEQ ID NO.3:

[0041] CCTTCCTGGAGTCCCTGAAAATGT;

[0042] 5'RACE nested PCR second PCR primer, SEQ ID NO.4:

[0043] TTCAGGAGATGATTCCGATGACC

[0044] 3'RACE nested PCR first PCR primer, SEQ ID NO.5:

[0045] TCCATTGGTTGGCTGGGAGGCGG;

[0046] 3' RACE Nested PCR Second PCR Primers. SEQ ID NO.6:

[0047] ACATTCGCTCAAGTCCACATCCG;

[0048] After experimental verification, the nested PCR primers can achieve the expected experimental purpose and specifically amplify the target fragment.

[0049] The total RNA of human SGC-7901 cells was routinely extracted by Trizol method. Then press Clontech RACE 5' / 3' kit (Cat. No. 634860) instruction manual for...

Embodiment 2

[0072] Embodiment 2 A kind of kit for the diagnosis of gastric cancer

[0073] 1. A kit for diagnosing gastric cancer, comprising a primer set for detecting gastric cancer, a positive quality control product and a primer for the internal reference gene GAPDH. Wherein, the sequence of the primer set used for gastric cancer detection is shown in SEQ ID NO: 7-8; the positive quality control product is a recombinant vector inserted into the cDNA sequence of lncRNA SGOL1-AS1 or a fragment thereof; the internal reference gene GAPDH primer is shown in SEQ ID NO: 9 ~10 shown. All other reagents used in this kit are commercially available.

[0074] 2. Detection method

[0075] (1) Extract sample RNA with Trizol, the specific steps are as follows:

[0076] (1) Add an appropriate amount of Trizol to the sample, and crack the sample for 15 minutes at room temperature.

[0077] (II) Add 0.2ml of chloroform to every milliliter of Trizol, shake and mix well, and let stand at room tempera...

Embodiment 4

[0109] Example 4 Detection of gastric cancer patients and healthy human platelet samples

[0110] 1. Whole blood was collected from 50 patients with gastric cancer and 45 healthy people. All patients and healthy people knew and agreed to the test.

[0111] 2. Platelet samples

[0112] Collect 5 mL of fresh blood on an empty stomach, store it in EDTA anticoagulant tubes, and keep it at room temperature for no more than 1 hour. Centrifuge at 150g room temperature for 10min, absorb the platelet-rich plasma in the upper layer, then centrifuge at 400g for 20min at room temperature, suck off the supernatant, and precipitate into platelets, add 30μl RNAlater to the platelets, overnight at 4, transfer to -80°C for long-term storage.

[0113] 3. The above samples were tested according to the method described in Example 2.

[0114] 4. Results: The expression of lncRNASGOL1-AS1 in platelets of patients with gastric cancer was significantly lower than that in platelets of healthy people...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of lncRNA SGOL1-AS1 serving as a marker for diagnosing stomach cancer. The cDNA sequence of the lncRNA SGOL1-AS1 is as shown in SEQ ID NO:1. The invention discoversapplication of the lncRNA SGOL1-AS1 or a fragment thereof serving as a marker for diagnosing stomach cancer. A stomach cancer diagnosing kit constructed by the invention comprises a pair of specificdetection primers which can be used for detecting tissue specimens as well as blood specimens such as plasma, serum and platelet. A non-invasive diagnostic mode aiming at blood specimens has better clinical application value, can achieve a good detection effect at the early stage of stomach cancer, and has very high popularization value.

Description

technical field [0001] The present invention relates to the technical field of diagnosis of gastric cancer, and more specifically, relates to the application of lncRNA SGOL1-AS1 as a diagnostic marker of gastric cancer. Background technique [0002] Gastric cancer is one of the most common malignant tumors in the world. Its incidence rate ranks fourth among all malignant tumors, and its mortality rate ranks second. There are as many as 1 million new cases of gastric cancer every year in the world, and about 700,000 patients die. Its 5-year survival rate is less than 20%, while the 5-year survival rate of early gastric cancer after treatment can reach more than 90%. Therefore, early diagnosis is very important to improve the curative effect of gastric cancer. At present, the most valuable method for the diagnosis of gastric cancer is gastroscopy. However, gastroscopy is an invasive examination and is not suitable as a routine screening examination. Gastric cancer markers ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/113
CPCC12Q1/6886C12Q2600/158C12Q2600/178
Inventor 邓敏杨文娟刑珊宋莹
Owner CANCER CENT OF GUANGZHOU MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More