A kind of ternary complex toxin with anti-tumor activity and its preparation method
A ternary compound and toxin technology, which is applied in the fields of antineoplastic drugs, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problem that there is no relevant research and report on the antitumor activity of SrfABC toxin
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] The ternary compound toxin with anti-tumor activity of the present embodiment, its coding gene is derived from the entomopathogenic nematode symbiotic pathogenic bacteria Xenorhabdus stockiae HN_xs01 (CCTCC NO: M2012069) (see CN103074282A), which is the xsrfABC gene (ie SrfABC toxin gene), The xsrfABC gene contains three open reading frames (ORFs): xsrfA (1395bp), xsrfB (3021bp) and xsrfC (2682bp). The nucleotide sequence of xsrfA is shown in SEQ ID NO:1 in the sequence listing, the nucleotide sequence of xsrfB is shown in SEQ ID NO:2 in the sequence listing, and the nucleotide sequence of xsrfC is shown in SEQ ID NO:3 in the sequence listing.
[0058] The amino acid sequence of the ternary compound toxin (XSrfABC) with anti-tumor activity in this embodiment, the amino acid sequence of the protein encoded by the xsrfA gene is shown in the sequence listing SEQ ID NO: 4, and the amino acid sequence of the protein encoded by the xsrfB gene is shown in the sequence listing S...
Embodiment 2
[0061] Example 2 Screening of clones that are toxic to tumor cells
[0062] Take out the cryopreservation tubes of tumor cells (Hela cells and B16 cells) from the liquid nitrogen tank, quickly paddle back and forth in a 37°C water bath to melt them, add 7mL of 1640 medium, and culture them at 37°C. After the tumor cells grew for 24 hours, discard the waste liquid, wash twice with 3mL PBS (phosphate buffer saline), add 1mL 0.25wt% trypsin to digest at 37°C for 30s, add 4mL fresh medium to stop the enzyme reaction, and press the cells The "Z" was broken up, centrifuged at 1000rpm for 5min, the supernatant was poured out, and 8mL of medium was added to suspend the cells, then all were transferred to a petri dish, and cultured at 37°C.
[0063] Take out the cloning tube of the pathogenic bacilli genome Fosmid library obtained in Example 1, inoculate 10 μL into 20 mL of LB liquid medium containing Cm (chloramphenicol) 12.5 μg / mL, culture with shaking at 37 ° C for 24 h; collect the...
Embodiment 3
[0064] Example 3 Construction of expression vector pSC101-BAD-xsrfABC
[0065] Primers (hyg-pBAD-F: ACGCGGATCCACCTGCAGTGTTACATTGC; hyg-pBAD-R: ACGCGTCGACATAGTGAATTCCTCCTGCTAGC) were designed to amplify the ORF of the xsrfABC gene with high-fidelity Taq enzyme. , 72°C 4min) a total of 30 cycles, 72°C 10min. After double digestion with BamH I and SalI, it was cloned into the pSC101-BAD-hyg plasmid kept in the laboratory, transformed into the Escherichia coli host GB05 strain, and the recombinant strain GB05 (XSrfABC) was obtained, and the expression of XSrfABC toxin was induced. The clones with positive transformation were selected by PCR identification, and further identified by sequencing. figure 1 It is a schematic diagram of the expression plasmid pSC101-BAD-xsrfABC.
[0066] The XSrfABC toxin was formulated into solutions with different concentrations, and the different concentrations of XSrfABC toxin proteins were added to tumor cells and normal cells, and the effect of ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


