Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of ternary complex toxin with anti-tumor activity and its preparation method

A ternary compound and toxin technology, which is applied in the fields of antineoplastic drugs, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problem that there is no relevant research and report on the antitumor activity of SrfABC toxin

Active Publication Date: 2021-07-20
HUNAN NORMAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the existing research reports mainly focus on the sequence characteristics of the gene island where SrfABC toxoid is located and the regulation of toxin expression. No relevant studies and reports on tumor activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of ternary complex toxin with anti-tumor activity and its preparation method
  • A kind of ternary complex toxin with anti-tumor activity and its preparation method
  • A kind of ternary complex toxin with anti-tumor activity and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] The ternary compound toxin with anti-tumor activity of the present embodiment, its coding gene is derived from the entomopathogenic nematode symbiotic pathogenic bacteria Xenorhabdus stockiae HN_xs01 (CCTCC NO: M2012069) (see CN103074282A), which is the xsrfABC gene (ie SrfABC toxin gene), The xsrfABC gene contains three open reading frames (ORFs): xsrfA (1395bp), xsrfB (3021bp) and xsrfC (2682bp). The nucleotide sequence of xsrfA is shown in SEQ ID NO:1 in the sequence listing, the nucleotide sequence of xsrfB is shown in SEQ ID NO:2 in the sequence listing, and the nucleotide sequence of xsrfC is shown in SEQ ID NO:3 in the sequence listing.

[0058] The amino acid sequence of the ternary compound toxin (XSrfABC) with anti-tumor activity in this embodiment, the amino acid sequence of the protein encoded by the xsrfA gene is shown in the sequence listing SEQ ID NO: 4, and the amino acid sequence of the protein encoded by the xsrfB gene is shown in the sequence listing S...

Embodiment 2

[0061] Example 2 Screening of clones that are toxic to tumor cells

[0062] Take out the cryopreservation tubes of tumor cells (Hela cells and B16 cells) from the liquid nitrogen tank, quickly paddle back and forth in a 37°C water bath to melt them, add 7mL of 1640 medium, and culture them at 37°C. After the tumor cells grew for 24 hours, discard the waste liquid, wash twice with 3mL PBS (phosphate buffer saline), add 1mL 0.25wt% trypsin to digest at 37°C for 30s, add 4mL fresh medium to stop the enzyme reaction, and press the cells The "Z" was broken up, centrifuged at 1000rpm for 5min, the supernatant was poured out, and 8mL of medium was added to suspend the cells, then all were transferred to a petri dish, and cultured at 37°C.

[0063] Take out the cloning tube of the pathogenic bacilli genome Fosmid library obtained in Example 1, inoculate 10 μL into 20 mL of LB liquid medium containing Cm (chloramphenicol) 12.5 μg / mL, culture with shaking at 37 ° C for 24 h; collect the...

Embodiment 3

[0064] Example 3 Construction of expression vector pSC101-BAD-xsrfABC

[0065] Primers (hyg-pBAD-F: ACGCGGATCCACCTGCAGTGTTACATTGC; hyg-pBAD-R: ACGCGTCGACATAGTGAATTCCTCCTGCTAGC) were designed to amplify the ORF of the xsrfABC gene with high-fidelity Taq enzyme. , 72°C 4min) a total of 30 cycles, 72°C 10min. After double digestion with BamH I and SalI, it was cloned into the pSC101-BAD-hyg plasmid kept in the laboratory, transformed into the Escherichia coli host GB05 strain, and the recombinant strain GB05 (XSrfABC) was obtained, and the expression of XSrfABC toxin was induced. The clones with positive transformation were selected by PCR identification, and further identified by sequencing. figure 1 It is a schematic diagram of the expression plasmid pSC101-BAD-xsrfABC.

[0066] The XSrfABC toxin was formulated into solutions with different concentrations, and the different concentrations of XSrfABC toxin proteins were added to tumor cells and normal cells, and the effect of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A ternary compound toxin with anti-tumor activity and its preparation method, the ternary compound toxin with anti-tumor activity of the present invention, its coding gene is derived from the entomopathogenic nematode symbiotic pathogenic bacteria Xenorhabdus stockiae HN_xs01, for wxya Gene, wxya The gene contains three open reading frames: xsrfA, xsrfB and wxya , wxya The nucleotide sequence is shown in the sequence table SEQ ID NO: 1, wxya The nucleotide sequence is shown in the sequence table SEQ ID NO: 2, wxya The nucleotide sequence is shown in the sequence listing SEQ ID NO:3. The invention also includes the preparation method of the ternary complex toxin with anti-tumor activity. In the present invention, the resulting complex toxin XSrfABC is toxic to tumor cells but not to normal cells.

Description

technical field [0001] The invention relates to a ternary compound toxin with antitumor activity and a preparation method thereof. Background technique [0002] According to the statistics of the World Health Organization, 3 / 5 of the people in the world die from the four major diseases of malignant tumors, diabetes, cardiovascular diseases, and chronic respiratory diseases, and malignant tumors are one of the main causes of death. Anti-tumor active ingredients derived from microorganisms have novel structures and unique mechanisms of action, and have good development potential. Xia Liqiu et al. isolated an entomopathogenic nematode symbiotic pathogenic bacterium Xenorhabdus stockiae HN_xs01 (CCTCC NO: M2012069) with tumor targeting, and isolated four secondary metabolites with antitumor activity - changsamycin A , changsamycin B, changsamycin C, changsamycin D; in the further study of anti-tumor active substances in X.stockiae HN_xs01, a ternary compound toxin with anti-tum...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C12N15/70C07K14/24A61K38/16A61P35/00
CPCA61K38/00C07K14/24C12N15/70
Inventor 胡胜标胡晓凤谢亚丽张国勇杨曦夏立秋丁学知彭智辉
Owner HUNAN NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com