Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of miR-134 and accelerant thereof in preparing medicines for treating osteosarcoma

A technology of 1. mir-134 and therapeutic drugs, applied in the fields of biotechnology and medicine

Inactive Publication Date: 2018-06-01
THE SECOND HOSPITAL OF SHANXI MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, studies have found that micro non-coding RNA (miRNA) plays an important role in the occurrence and development of osteosarcoma, but whether miR-134 plays a role in the growth of osteosarcoma by inhibiting angiogenesis has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-134 and accelerant thereof in preparing medicines for treating osteosarcoma
  • Application of miR-134 and accelerant thereof in preparing medicines for treating osteosarcoma
  • Application of miR-134 and accelerant thereof in preparing medicines for treating osteosarcoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0120] Example 1 Low expression of miR-134 in osteosarcoma cell lines and human osteosarcoma tissues

[0121] qRT-PCR verified 3 cell lines and normal osteoblasts, 11 cases of human osteosarcoma tissues and 6 cases of normal bone tissues. The results showed that endogenous miR-134 expression was decreased in osteosarcoma cell lines compared with normal osteoblasts (P=0.011, Figure 1A ). Compared with normal human bone tissue, the expression of endogenous miR-134 in osteosarcoma tissue decreased (P Figure 1B ,). This result demonstrates that miR-134 expression level is decreased in osteosarcoma compared with normal bone.

Embodiment 2

[0122] Example 2 miR-134 inhibits osteosarcoma cell proliferation and angiogenesis in vitro

[0123] The osteosarcoma cell line Saos-2 was transiently transfected with miR-134mimic{hsa-miR-134-5p sequence(maturemiR-134):UGUGACUGGUUGACCAGAGGGG, SEQ ID NO.1} and miR-Control{Negative controlmiR sequence(with no homology to human gene sequences): GGUUCGUACGUACACUGUUCA, SEQ ID NO.2}, the transfection efficiency is up to 90%. qRT-PCR verified the transfection efficiency, and the expression level of miR-134 was more than 600 times higher than that of the control group (P Figure 2A ). In order to verify the cell proliferation ability, the cells were counted within 5 days after transfection, and the results showed that the number of cells transfected with miR-134 decreased significantly on the 3rd, 4th, and 5th day (P Figure 2B ). In addition, we used angiogenesis assay (HUVEC tube formation assay), and the results showed that miR-134 at concentrations of 10nM and 40nM both decreased ...

Embodiment 3

[0124] Example 3 miR-134 inhibits tumor formation and angiogenesis in animal transplantation models

[0125] The lentivirus stably transfected miR-134, where the miR-134 was the same as the miR-134mimic sequence in Example 2, and entered the osteosarcoma cell line Saos-2, with a transfection efficiency of 95%. LV-miR-134 and LV–control group were respectively 10 6 The cells were injected subcutaneously in the back of 4-week-old nude mice, and the growth of tumors was monitored. After 5 weeks, the animals were sacrificed, and the tumors were harvested. The results showed: Tumor volume: (miR-134group: [555.48±134.96mm 3 ]VS miR-control group: [2274.51±935.09mm 3 ], P Figure 3A and Figure 3B ), tumor weight: (miR-134group:[1.288±0.147g]VS miR-control group:[2.643±0.686g], P Figure 3C ). Nude mice 3 weeks after inoculation were injected with AngioSense into the tail vein, and scanned by FMT to verify angiogenesis. The results showed that angiogenesis in the miR-134 group was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of bio-technology and medicines, and in particular relates to an application of miR-134 and an accelerant thereof in preparing medicines for treating osteosarcoma.Based upon broad and deep researches, it is discovered for the first time that the miR-134 can achieve low expression in an osteosarcoma cell line and human osteosarcoma tissues, the miR-134 can inhibit osteosarcoma cell proliferation and angiogenesis activity in vitro and the miR-134 can inhibit oncogenesis and angiogenesis of an animal transplant model. Through further discovery, VEGFA and VEGFR1 are new targets of the miR-134; and the miR-134 can directly target to a VEGFA / VEGFR1 / AKT signaling pathway, so as to inhibit osteosarcoma growth and the angiogenesis. Therefore, the miR-134, whichcan function as a novel target for treating the osteosarcoma, is expected to serve as a biological weapon for solving the problem of osteosarcoma.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine, and specifically relates to the use of miR-134 and its promoter in the preparation of osteosarcoma treatment drugs. Background technique [0002] Osteosarcoma (OS) is the most common primary malignant bone tumor, which often occurs in adolescents. It is characterized by high malignancy, strong invasiveness, and early lung metastasis, which seriously threatens the health and life of patients. At present, a comprehensive treatment plan combining surgery and chemotherapy before and after surgery is usually used in clinical treatment. However, epidemiological investigations show that the 5-year survival rate of patients is about 55-68%, and the treatment effect is not satisfactory. Moreover, the existing chemotherapeutic drugs, due to their poor targeting, can cause many serious side effects such as: gastrointestinal tract reaction, bone marrow suppression, renal toxicity, myocardial toxici...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/7105A61P35/00A61P9/00
CPCA61K31/7105
Inventor 吕智孙晓娟张龙
Owner THE SECOND HOSPITAL OF SHANXI MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More