Application of miR-134 and accelerant thereof in preparing medicines for treating osteosarcoma
A technology of 1. mir-134 and therapeutic drugs, applied in the fields of biotechnology and medicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0120] Example 1 Low expression of miR-134 in osteosarcoma cell lines and human osteosarcoma tissues
[0121] qRT-PCR verified 3 cell lines and normal osteoblasts, 11 cases of human osteosarcoma tissues and 6 cases of normal bone tissues. The results showed that endogenous miR-134 expression was decreased in osteosarcoma cell lines compared with normal osteoblasts (P=0.011, Figure 1A ). Compared with normal human bone tissue, the expression of endogenous miR-134 in osteosarcoma tissue decreased (P Figure 1B ,). This result demonstrates that miR-134 expression level is decreased in osteosarcoma compared with normal bone.
Embodiment 2
[0122] Example 2 miR-134 inhibits osteosarcoma cell proliferation and angiogenesis in vitro
[0123] The osteosarcoma cell line Saos-2 was transiently transfected with miR-134mimic{hsa-miR-134-5p sequence(maturemiR-134):UGUGACUGGUUGACCAGAGGGG, SEQ ID NO.1} and miR-Control{Negative controlmiR sequence(with no homology to human gene sequences): GGUUCGUACGUACACUGUUCA, SEQ ID NO.2}, the transfection efficiency is up to 90%. qRT-PCR verified the transfection efficiency, and the expression level of miR-134 was more than 600 times higher than that of the control group (P Figure 2A ). In order to verify the cell proliferation ability, the cells were counted within 5 days after transfection, and the results showed that the number of cells transfected with miR-134 decreased significantly on the 3rd, 4th, and 5th day (P Figure 2B ). In addition, we used angiogenesis assay (HUVEC tube formation assay), and the results showed that miR-134 at concentrations of 10nM and 40nM both decreased ...
Embodiment 3
[0124] Example 3 miR-134 inhibits tumor formation and angiogenesis in animal transplantation models
[0125] The lentivirus stably transfected miR-134, where the miR-134 was the same as the miR-134mimic sequence in Example 2, and entered the osteosarcoma cell line Saos-2, with a transfection efficiency of 95%. LV-miR-134 and LV–control group were respectively 10 6 The cells were injected subcutaneously in the back of 4-week-old nude mice, and the growth of tumors was monitored. After 5 weeks, the animals were sacrificed, and the tumors were harvested. The results showed: Tumor volume: (miR-134group: [555.48±134.96mm 3 ]VS miR-control group: [2274.51±935.09mm 3 ], P Figure 3A and Figure 3B ), tumor weight: (miR-134group:[1.288±0.147g]VS miR-control group:[2.643±0.686g], P Figure 3C ). Nude mice 3 weeks after inoculation were injected with AngioSense into the tail vein, and scanned by FMT to verify angiogenesis. The results showed that angiogenesis in the miR-134 group was...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



