Improved promoter, T carrier composed of promoter, and applications of promoter

A technology of promoter and vector, applied in the field of genetic engineering, can solve the problem of T vector being unable to be cloned, and achieve the effect of avoiding the defects of false positive clones, and avoiding false positives and false negatives.

Active Publication Date: 2018-06-15
GENEWIZ INC SZ
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Therefore, the technical problem to be solved in the present invention is to overcome that the T vector prepared in the prior art cannot be cloned, or produce a large number of false positive or false negative clones, thereby providing an improved promoter and the T vector of its composition and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved promoter, T carrier composed of promoter, and applications of promoter
  • Improved promoter, T carrier composed of promoter, and applications of promoter
  • Improved promoter, T carrier composed of promoter, and applications of promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Example 1: Construction and functional verification of high-copy cloning vectors

[0083] This embodiment provides a method for constructing a high-copy cloning vector, including the following specific steps:

[0084] 1) The lacZα gene of pUC57 (kanamycin resistance) is replaced by the ccdB gene, specifically as follows:

[0085] (1) Whole gene synthesis ccdB gene (synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.), the nucleotide sequence is shown in SEQID NO.11:

[0086] ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGAT ATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAA;

[0087] (2) Using the pUC57 plasmid with kanamycin resistance as a template and using SEQ ID NO.29-30 as primers for PCR amplification reaction, the specific sequence is as follows:

[008...

Embodiment 2

[0158] Embodiment 2 Cloning carrier of the present invention overcomes the experimental verification of false positive clones

[0159] Construction of three pUC57-ccdB-lacI-Mu-4-T mutant plasmids (pUC57-ccdB-lacI-Mu-4-T-Mim-1, pUC57-ccdB-lacI-Mu-4-T-Mim-2, pUC57 -ccdB-lacI-Mu-4-T-Mim-3) simulates the pUC57-ccdB-lacI-Mu-4-T vector with a deletion of 1-2 bases at both ends of the restriction site and self-ligation. The construction steps are as follows:

[0160] (1) Using the plasmid pUC57-ccdB-lacI-Mu-4-T constructed in Example 1 as a template, F1-del+R1-del, F2-del+R2-del, F3-del+R3-del Carry out PCR amplification reaction for primer, the nucleotide sequence of described primer F1-del, R1-del, F2-del, R2-del, F3-del, R3-del is as SEQ ID No.37-SEQ ID No. 42, the details are as follows:

[0161] SEQ ID NO. 37 (F1-del): ACAACATACGAGATTCAGCATAAAGTGTAAAGCCTGGGGTGC;

[0162] SEQ ID NO. 38 (R1-del): CTTTATGCTGAATCTCGTATGTTGTGTGGAATTGTGAGC;

[0163] SEQ ID NO. 39 (F2-del): CACAACA...

Embodiment 3

[0172] Example 3: Construction and functional verification of low-copy T vectors

[0173] This embodiment provides a method for constructing a low-copy T vector, comprising the following steps:

[0174] 1) The lacZα gene of pCK (kanamycin resistance) is replaced by the ccdB gene, as follows:

[0175] (1) Using the pCK plasmid with kanamycin resistance as a template and using SEQ ID NO.43-44 as primers to carry out PCR amplification reaction, the specific sequence is as follows:

[0176] SEQ ID NO.43 (forward primer): TTATAGGTGTAAACCTTAAACTGCATAGCTGTTTCCTGTGTGAAATTGTTATCC;

[0177] SEQ ID NO.44 (reverse primer): TTAACCTGATGTTCTGGGGAATATAATTAAGCCAGCCCCGAGTAGCTAGACAGG;

[0178] PCR reaction system is as shown in embodiment 2 table 1, and reaction condition is as shown in embodiment 2 table 2:

[0179] (2) The PCR reaction solution obtained in step (1) is subjected to 1% agarose gel electrophoresis and then gel-cut to recover and purify to obtain a PCR amplification product;

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and relates to an improved promoter and applications thereof. The nucleic acid sequences between -35 area to -10 area of the promoter region aremutated into recognition sites of endonuclease. The problem that a blue-white selected carrier has a strong promoter, which starts the transcription or translation of an exogenous gene, the product may be toxic to a host, and the cloning cannot be carried out is solved. The defect of false positive cloning caused by gene frame shift mutation due to 1 to 2 bp loss of the cleavage sites of the carrier is overcome. The false negative phenomenon that a plane is fully of blue spots is eliminated, wherein the false negative phenomenon is generated because the exogenous DNA fragment is small, and the gene reading frame is not changed by the insertion of the exogenous DNA.

Description

technical field [0001] The present invention belongs to the field of genetic engineering, relates to an improved promoter, a T vector composed of it and applications thereof, in particular to an improved promoter, a T vector with the improved promoter, and a T vector with the T vector Host cells and their applications. Background technique [0002] The invention of PCR technology is a major breakthrough in the fields of molecular biology and genetic engineering. After the birth of PCR technology, the technology of cloning PCR products into vectors (usually plasmids) has also been developed. Common and relatively simple cloning methods include TA cloning and blunt-end ligation. The PCR product amplified by Taq enzyme contains dAMP tail, and under the action of T4 ligase, it can be ligated with the carrier (T carrier) containing T-terminus, which is TA clone. High-fidelity DNA polymerases usually contain 3'-5' exonuclease activity, and the PCR products amplified by them are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/70C12N15/66C12N1/21C12R1/19
CPCC12N9/2471C12N15/66C12N15/70C12N2800/22C12Y302/01023
Inventor薛高旭贾延凯齐甜铭冯爱华谢正立吴昕孙中平廖国娟
OwnerGENEWIZ INC SZ