Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pre-T vector and T vector composed of pre-T vector and application thereof

A carrier and cloning carrier technology, applied in the field of genetic engineering, can solve the problem that T vectors cannot be cloned, and achieve the effect of avoiding false positives, false positives and false negatives

Active Publication Date: 2018-09-28
GENEWIZ INC SZ
View PDF9 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Therefore, the technical problem to be solved in the present invention is to overcome the T carrier prepared in the prior art that cannot be cloned, or produce a large number of false positive or false negative clones, thereby providing a kind of former T carrier and its composition T carrier and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pre-T vector and T vector composed of pre-T vector and application thereof
  • Pre-T vector and T vector composed of pre-T vector and application thereof
  • Pre-T vector and T vector composed of pre-T vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1: Codon optimized lacZα gene

[0069] Codon-optimized lacZα gene, comprising the following steps:

[0070] The lacZα gene (SEQ ID NO.4) of pUC57 was codon optimized using codon optimization software (Codon optimization software, developed by Suzhou Jinweizhi Biotechnology Co., Ltd.), and the optimized lacZα gene was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. , the nucleotide sequence is shown in SEQ ID No.4, specifically as follows:

[0071] lacZα基因(SEQ ID NO.4):ATGACCATGCTCGAGCCAAGCTTGCATGCAGGCCTCTGCAGTCGACGGGCCCGGGATCCGATATCTAGATGCATTCGCGAGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAG;

[0072] 优化后的lacZα基因(SEQ ID NO.5):ATGACCATGCTGGAACCGAGCCTGCATGCAGGTCTGTGCAGCCGTCGTGCACGCGATCCGATTAGCCGCTGCATTCGCGAAGTGCCGAGCAGCAATAGCCTGGCCGTGGT...

Embodiment 2

[0073] Embodiment 2: Construction of high copy T vector

[0074] The construction method of high-copy cloning vector comprises the following specific steps:

[0075] 1) adopt the optimized lacZα gene in Example 1 to replace the lacZα gene of pUC57 (kanamycin resistance), specifically as follows:

[0076] (1) Using the pUC57 plasmid with kanamycin resistance as a template and using SEQ ID NO.6-7 as primers for PCR amplification reaction, the specific sequence is as follows:

[0077] SEQ ID NO.6 (forward primer): ATGCAGGCTCGGTTCCAGCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCC;

[0078] SEQ ID NO.7 (reverse primer): AGCACCATTTGCAGCGATGCCGCCTAATTAAGCCAGCCCCGACACCCGCCAACAC;

[0079] The PCR reaction system is shown in Table 1 below:

[0080] Table 1

[0081] template

About 50ng, 0.5μL

forward primer

10pM, 0.5μL

reverse primer

10pM, 0.5μL

dNTP

5mM each, 0.5μL

5×PCR buffer

10 μL

pfu DNA polymerase

5U / μL, 0.5μL

h ...

Embodiment 3

[0132] Example 3 pUC57-T carrier overcomes the experimental verification of false positive clones

[0133] Construct pUC57-T-MU-1, pUC57-T-MU-2, pUC57-T-MU-3, pUC57-T-MU-4 plasmids to simulate the deletion of 1-2 bases at both ends of the restriction site of pUC57-T The base and self-connection occur, and the construction steps are as follows:

[0134] (1) Using the plasmid pUC57-T constructed in Example 2 as a template, F-MU-1+R-MU-1, F-MU-2+R-MU-2, F-MU-3+R -MU-3, F-MU-4+R-MU-4 are primers for PCR amplification reaction, the primers F-MU-1, R-MU-1, F-MU-2, R-MU-2 The nucleotide sequences of F-MU-3, R-MU-3, F-MU-4 and R-MU-4 are shown in SEQ ID NO.14-SEQ ID NO.21, specifically as follows:

[0135] SEQ ID NO. 14 (F-MU-1): ACATACGAGGACATCAGTCAAAGTGTAAAGCCTGGGGTGCCT;

[0136] SEQ ID NO. 15 (R-MU-1): TTACACTTTGACTGATGTCCTCGTATGTTGTGTGGAATTGTG;

[0137] SEQ ID NO. 16 (F-MU-2): AACATACGAGGACACAGTCAAAGTGTAAAGCCTGGGGTGCCT;

[0138] SEQ ID NO. 17 (R-MU-2): TTACACTTTGACTGTGTCCTCGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering and relates to a pre-T vector and a T vector composed of the pre-T vector and application thereof. The improved promoter is a recognition site for mutation from a nucleotide sequence from -35 region to -10 region in a promoter region into endonuclease. By the T vector, the problem that the product of transcription or translation of exogenous genes by a strong promoter during blue-white selection of a vector might be toxic to host and cloning will fail can be overcome, blue-white selection of a vector might be toxic to host as a strong promoter starts transcription or translation; the defect that delection of 1-2 bp at enzyme digestion site leads to lacZalpha gene frameshift mutation and false positive clones are generated can be avoided; and the false negative phenomenon that a plate is full of blue stains because exogenous DNA fragment is small and insertion of exogenous DNA does not change a reading frame of lacZalpha gene can beeliminated.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to a pre-T vector and the T vector composed of the same and applications thereof, in particular to a pre-T vector, the T vector, a host cell with the T vector and the application thereof. Background technique [0002] The invention of PCR technology is a major breakthrough in the fields of molecular biology and genetic engineering. After the birth of PCR technology, the technology of cloning PCR products into vectors (usually plasmids) has also been developed. Common and relatively simple cloning methods include TA cloning and blunt-end ligation. The PCR product amplified by Taq enzyme contains dAMP tail, and under the action of T4 ligase, it can be ligated with the carrier (T carrier) containing T-terminus, which is TA clone. High-fidelity DNA polymerases usually contain 3'-5' exonuclease activity, and the PCR products amplified by them are blunt ends. Ligation of these fragments...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/66C12N1/21C12R1/19
CPCC12N9/2471C12N15/66C12N15/70C12N2800/22C12Y302/01023
Inventor 薛高旭谢正立冯爱华齐甜铭贾延凯吴昕孙中平廖国娟
Owner GENEWIZ INC SZ
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com