A kind of improved promoter and the t vector of its composition and application

A technology of promoters and recombinant vectors, applied in the field of genetic engineering, can solve problems such as the inability to clone T vectors, and achieve the effects of easy operation, high efficiency, and simple construction methods

Active Publication Date: 2021-06-29
GENEWIZ INC SZ
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Therefore, the technical problem to be solved in the present invention is to overcome that the T vector prepared in the prior art cannot be cloned, or produce a large number of false positive or false negative clones, thereby providing an improved promoter and the T vector of its composition and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of improved promoter and the t vector of its composition and application
  • A kind of improved promoter and the t vector of its composition and application
  • A kind of improved promoter and the t vector of its composition and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Example 1: Codon optimized lacZα gene

[0086] Codon-optimized lacZα gene, comprising the following steps:

[0087] The lacZα gene (SEQ ID NO.36) of pUC57 was codon optimized using codon optimization software (Codon optimization software, developed by Suzhou Jinweizhi Biotechnology Co., Ltd.), and the optimized lacZα gene was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. , the nucleotide sequence is shown in SEQ ID No.36, specifically as follows:

[0088] lacZα基因(SEQ ID NO.36):ATGACCATGCTCGAGCCAAGCTTGCATGCAGGCCTCTGCAGTCGACGGGCCCGGGATCCGATATCTAGATGCATTCGCGAGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAG;

[0089] 优化后的lacZα基因(SEQ ID NO.37):ATGACCATGCTGGAACCGAGCCTGCATGCAGGTCTGTGCAGCCGTCGTGCACGCGATCCGATTAGCCGCTGCATTCGCGAAGTGCCGAGCAGCAATAGCCTGGCCG...

Embodiment 2

[0090] Embodiment 2: Construction of high copy cloning vector

[0091] The construction method of high-copy cloning vector comprises the following specific steps:

[0092] 1) adopt the optimized lacZα gene in Example 1 to replace the lacZα gene of pUC57 (kanamycin resistance), specifically as follows:

[0093] (1) Using the pUC57 plasmid with kanamycin resistance as a template and using SEQ ID NO.38-39 as primers to carry out PCR amplification reaction, the specific sequence is as follows:

[0094] SEQ ID NO.38 (forward primer): ATGCAGGCTCGGTTCCAGCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCC;

[0095] SEQ ID NO.39 (reverse primer): AGCACCATTTGCAGCGATGCCGCCTAATTAAGCCAGCCCCGACACCCGCCAACAC;

[0096] The PCR reaction system is shown in Table 1 below:

[0097] Table 1

[0098]

[0099] Wherein, one group is the negative control of sample with water;

[0100] The reaction conditions are shown in Table 2 below:

[0101] Table 2

[0102]

[0103]

[0104] (2) The PCR reaction ...

Embodiment 3

[0153] Embodiment 3 Cloning carrier of the present invention overcomes the experimental verification of false positive clones

[0154] Construct pUC57-lacZ-Mu-2-T-Mim-1, pUC57-lacZ-Mu-2-T-Mim-2, pUC57-lacZ-Mu-2-T-Mim-3 plasmids to simulate pUC57-lacZ-Mu- The 2-T vector lacks 1-2 bases at both ends of the restriction site and undergoes self-ligation. The construction steps are as follows:

[0155] (1) Using the plasmid pUC57-lacZ-Mu-2-T constructed in Example 2 as a template, F-MU-1+R-MU-1, F-MU-2+R-MU-2, F -MU-3+R-MU-3 is a primer for PCR amplification reaction, the primers F-MU-1, R-MU-1, F-MU-2, R-MU-2, F-MU-3 , R-MU-3, the nucleotide sequence shown in SEQ ID NO.44-SEQ ID NO.49, specifically as follows:

[0156] SEQ ID NO. 44 (F-MU-1): CGAGCCGGAGAATCAAGTGTAAAGCCTGGGGTGCCTAATGAG;

[0157] SEQ ID NO. 45 (R-MU-1): CAGGCTTTACACTTGATTCTCCGGCTCGTATGTTGTGTGGAATTGTG;

[0158] SEQ ID NO. 46 (F-MU-2): TACGAGCCGGAGATTCAAGTGTAAAGCCTGGGGTGCCTAATGAG;

[0159] SEQ ID NO. 47 (R-MU-2): ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering, and relates to an improved promoter and its application. The improved promoter is to mutate the nucleic acid sequence between the -35 region and the -10 region in the promoter region into an endonuclease recognition site. The invention can overcome the problem of inability to clone due to the presence of a strong promoter in the blue-white screened vector to initiate the transcription or translation of the exogenous gene, which may be toxic to the host, and can avoid the loss of 1-2 bp in the restriction site of the vector, resulting in lacZα The defect of false-positive clones produced by gene frameshift mutation can eliminate the false-negative phenomenon that the plate is full of blue spots due to the small size of the foreign DNA fragment and the insertion of the foreign DNA does not change the reading frame of the lacZα gene.

Description

technical field [0001] The present invention belongs to the field of genetic engineering, relates to an improved promoter, a T vector composed of it and applications thereof, in particular to an improved promoter, a T vector with the improved promoter, and a T vector with the T vector Host cells and their applications. Background technique [0002] The invention of PCR technology is a major breakthrough in the fields of molecular biology and genetic engineering. After the birth of PCR technology, the technology of cloning PCR products into vectors (usually plasmids) has also been developed. Common and relatively simple cloning methods include TA cloning and blunt-end ligation. The PCR product amplified by Taq enzyme contains dAMP tail, and under the action of T4 ligase, it can be ligated with the carrier (T carrier) containing T-terminus, which is TA clone. High-fidelity DNA polymerases usually contain 3'-5' exonuclease activity, and the PCR products amplified by them are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/70C12N15/66C12N1/21C12R1/19
CPCC12N9/2465C12N15/66C12N15/70C12N2800/22C12Y302/01022
Inventor薛高旭谢正立冯爱华齐甜铭贾延凯吴昕孙中平廖国娟
OwnerGENEWIZ INC SZ