A female-specific marker of Chinese giant salamander and its application

A giant salamander, specific technology, applied in the direction of biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of lagging development of gender-specific molecular markers, and achieve low cost and accurate identification results

Active Publication Date: 2021-03-23
YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the development of sex-specific molecular markers in amphibians is relatively lagging behind, and only a few species are currently seen, such as the European tree frog (Hyla arborea group) (2006), the Heilongjiang wood frog (Rana amurensis Boulenge) (2009)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A female-specific marker of Chinese giant salamander and its application
  • A female-specific marker of Chinese giant salamander and its application
  • A female-specific marker of Chinese giant salamander and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] A preparation method for sex-specific molecular markers of Chinese giant salamander, the steps of which are:

[0058] A. Cloning and verification of Chinese giant salamander RAD female-specific fragment:

[0059] 1) Analysis of RAD candidate female-specific fragments of Chinese giant salamander: compare the RAD sequencing data with the male genome data to obtain the candidate RAD female-specific fragments adf431 (SEQ ID NO.1) and adf340 (SEQ ID NO.2). Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA) was used to design specific primers, adf431a, adf431s, adf340a, adf340s.

[0060] 2) PCR product recovery, cloning, and sequencing.

[0061] The amplified product was recovered by gel cutting, connected to the PMD-18T cloning vector at 16°C, connected for 4 hours, transformed into TOP10 competent cells (Tiangen, Beijing), coated with ampicillin-containing plates and cultured overnight at 37°C, and the clones were picked in After culturing in ampic...

Embodiment 2

[0081] The application of a Chinese giant salamander sex-specific molecular marker in the sex identification of normal individuals and sex-reversed individuals of giant salamanders, the steps are:

[0082] 1) Identification of common giant salamander individuals with female-specific markers.

[0083] Using the established giant salamander sex identification system, 24 females and 24 males were sexed, and the results showed that there were two female-specific fragments adf431 (nucleotide sequence shown in SEQ ID NO.1) and adf340 (nucleotide sequence shown in SEQ ID NO. 2) Design primers

[0084] adf431a:TCCAGAATGAAGTCCTGGCCT,

[0085] adf431s: CGAGCCTCCATTGTGCCTT;

[0086] adf340a:TTAACGGCCCTAACACCAGG,

[0087] adf340s: GGTTTAGGGCGGCTCTGATT

[0088] A female-specific band consistent with the target size can be amplified in 24 female individuals, and a female-specific band cannot be amplified in 24 male individuals ( figure 2 , image 3 ), the identification accuracy was 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an Andrias davidianus female specific marker and applications thereof. The steps comprise: A, cloning and verifying a specific fragment: 1) analyzing Andrias davidianus RAD candidate female specific fragments, 2) recovering a PCR product, cloning, and sequencing, and 3) analyzing the cloned and sequenced sequence; B, identifying physiological gender through tissue slicing:1) fixing and storing a collected Andrias davidianus gonad sample, 2) carrying out step-by-step ethanol dehydration on the sample, and 3) slicing the gonad tissue, and observing and identifying the physiological gender of Andrias davidianus; C, establishing a genetic sex identification system: 1) extracting genomic DNA, 2) design specific primers, wherein a nucleotide sequence represented by the verified sequence SEQ ID NO.1 is cloned, and 3) carrying out PCR amplification according to the reaction system; and D, applying the specific molecular marker in the identification of common individuals and sex reversal individuals of Andrias davidianus. According to the present invention, the marker has advantages of simple operation, accuracy and reliability, and can identify the genetic gender of Andrias davidianus through the non-invasive sampling; and the system for identifying the gender of Andrias davidianus and the sex reversal Andrias davidianus is firstly established, the simple and easy-performing molecular biology method is provided for the genetic gender identification of Andrias davidianus, and the approach is provided for the subsequent gender control breeding of Andrias davidianus.

Description

technical field [0001] The invention belongs to the molecular marker and genetic sex identification technology in the technical field of aquatic organisms, and more specifically relates to a sex-specific molecular marker for Chinese giant salamander, and also relates to the use of a sex-specific molecular marker for Chinese giant salamander, especially for identifying the early sex and sexuality of giant salamander Molecular biology approaches to the inverted giant salamander. Background technique [0002] The Chinese giant salamander (Andrias davidianus), also known as the giant salamander, belongs to Amphibians, Cauracea, Cryptobranchidae, and the genus Giant Salamander (Yan Nan et al., 2010). It is widely distributed in 17 provinces including Shaanxi, Jiangxi, Sichuan, Hunan, and Hubei. District (Yu Fenglan et al., 2006). In recent years, due to human hunting and destruction of giant salamander habitats, the population of giant salamanders has declined sharply. In 1988,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6879C12Q1/6888C12Q2600/156
Inventor 胡乔木王全禾肖汉兵田海峰孟彦
Owner YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products