A female-specific marker of Chinese giant salamander and its application
A giant salamander, specific technology, applied in the direction of biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of lagging development of gender-specific molecular markers, and achieve low cost and accurate identification results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] A preparation method for sex-specific molecular markers of Chinese giant salamander, the steps of which are:
[0058] A. Cloning and verification of Chinese giant salamander RAD female-specific fragment:
[0059] 1) Analysis of RAD candidate female-specific fragments of Chinese giant salamander: compare the RAD sequencing data with the male genome data to obtain the candidate RAD female-specific fragments adf431 (SEQ ID NO.1) and adf340 (SEQ ID NO.2). Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA) was used to design specific primers, adf431a, adf431s, adf340a, adf340s.
[0060] 2) PCR product recovery, cloning, and sequencing.
[0061] The amplified product was recovered by gel cutting, connected to the PMD-18T cloning vector at 16°C, connected for 4 hours, transformed into TOP10 competent cells (Tiangen, Beijing), coated with ampicillin-containing plates and cultured overnight at 37°C, and the clones were picked in After culturing in ampic...
Embodiment 2
[0081] The application of a Chinese giant salamander sex-specific molecular marker in the sex identification of normal individuals and sex-reversed individuals of giant salamanders, the steps are:
[0082] 1) Identification of common giant salamander individuals with female-specific markers.
[0083] Using the established giant salamander sex identification system, 24 females and 24 males were sexed, and the results showed that there were two female-specific fragments adf431 (nucleotide sequence shown in SEQ ID NO.1) and adf340 (nucleotide sequence shown in SEQ ID NO. 2) Design primers
[0084] adf431a:TCCAGAATGAAGTCCTGGCCT,
[0085] adf431s: CGAGCCTCCATTGTGCCTT;
[0086] adf340a:TTAACGGCCCTAACACCAGG,
[0087] adf340s: GGTTTAGGGCGGCTCTGATT
[0088] A female-specific band consistent with the target size can be amplified in 24 female individuals, and a female-specific band cannot be amplified in 24 male individuals ( figure 2 , image 3 ), the identification accuracy was 10...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com