Unlock instant, AI-driven research and patent intelligence for your innovation.

A helper adenovirus for improving the packaging efficiency of high-capacity adenoviruses

An adenovirus, high-efficiency technology, applied in the field of auxiliary adenovirus, can solve the problems of auxiliary adenovirus contamination, etc., and achieve the effect of avoiding wild-type virus, complete removal, and high purity

Active Publication Date: 2021-03-26
SHAANXI NORMAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the technical problem of contamination of the above-mentioned helper adenovirus, the purpose of the present invention is to provide a new helper adenovirus that can more effectively remove the packaging signal and avoid the production of wild-type virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A helper adenovirus for improving the packaging efficiency of high-capacity adenoviruses
  • A helper adenovirus for improving the packaging efficiency of high-capacity adenoviruses
  • A helper adenovirus for improving the packaging efficiency of high-capacity adenoviruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Taking the helper adenovirus Ad helper1, which self-removes the packaging signal and has controllable expression of the pIX gene, as an example, the genome structure of the helper adenovirus is as follows:

[0024] Based on the type 5 adenovirus genome, the NCBI number of the type 5 adenovirus genome sequence is AC_000008. The DNA sequence between 193bp and 5196bp from the 5' end and the DNA sequence between 27893bp and 30990bp in the type 5 adenovirus genome were removed; the 192nd base and the 5197th base were removed from the 5' end of the type 5 adenovirus genome The loxp sequence, the adenovirus packaging signal Ψ, the Cre gene expression box, and the loxp sequence were inserted in sequence between the bases, and the direction of the two inserted loxp sequences was consistent; the 27892th base and the 30991st The pIX gene expression cassette and the IVa2 gene expression cassette were inserted between the bases.

[0025] The adenovirus packaging signal Ψ is placed ...

Embodiment 2

[0070] Taking the helper adenovirus Ad helper2, which self-removes the packaging signal and controls the expression of the pIX gene, as an example, the genome structure of the helper adenovirus is characterized by the fact that the N-terminal sequence of the Cre gene is a 4-base-long DNA at the 5' end of the Cre gene coding region. Fragment, the C-terminal sequence of the Cre gene is a 1049-base-long DNA fragment at the 3' end of the Cre gene coding region, and the adenovirus packaging signal is placed in reverse, and the distance between the 192nd base and the 5197th base at the 5' end of the adenovirus genome is The DNA sequence inserted between the bases is as follows:

[0071] ATAACTTCGTATAATGTATGCTATACGAAGTTATAAAACGCCAACTTTGACCCGGAACGCGGAAAACACCTGAGAAAAACACCTGGGCGAGTCTCCACGTAAACGGTCAAAGTCCCCGCGGCCCTAGACAAATATTACGCGCTATGAGTAACACAAAATTATTCAGATTTCACTTCCTCTTATTCAGTTTTCCCGCGAAAATGGCCAAATCTTACTCGGTTACGCCCAAATTTACTACAACATCCGCCTAAAACCGCGCGAAAATTGTCACTTCCTGTGTAAAACGCAAGAGTCTTCTCTGT...

Embodiment 3

[0074] Taking the helper adenovirus Ad helper3, which self-removes the packaging signal and controls the expression of the pIX gene, as an example, the genome structure of the helper adenovirus is characterized by the fact that the N-terminal sequence of the Cre gene is a DNA with a length of 1049 bases at the 5' end of the Cre gene coding region. Fragment, the C-terminal sequence of the Cre gene is a DNA fragment 4 bases long at the 3' end of the Cre gene coding region. The DNA sequence inserted between the bases is as follows:

[0075]ATAACTTCGTATAGCATACATTATACGAAGTTATAAAACGCCAACTTTGACCCGGAACGCGGAAAACACCTGAGAAAAACACCTGGGCGAGTCTCCACGTAAACGGTCAAAGTCCCCGCGGCCCTAGACAAATATTACGCGCTATGAGTAACACAAAATTATTCAGATTTCACTTCCTCTTATTCAGTTTTCCCGCGAAAATGGCCAAATCTTACTCGGTTACGCCCAAATTTACTACAACATCCGCCTAAAACCGCGCGAAAATTGTCACTTCCTGTGTAAAACGCAAGAGTCTTCTCTGTCTCGACAAGCCCAGTTTCTATTGGTCTCCTTAAACCTGTCTTGTAACCTTGATACTTACTCGCCATCTTCCAGCAGGCGCACCATTGCCCCTGTTTCACTATCCAGGTTACGGATATAGTTCATGACAATATTTACATTGGTCCAGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an auxiliary adenovirus for improving the packaging efficiency of a high-capacity adenovirus. DNA sequences of adenovirus type 5 genome from the 5' end 193 bp to to 5196 bp andDNA sequences from 27893 bp to 30990 bp are removed based on the adenovirus type 5 genome. A loxp sequence, an adenoviral packaging signal Psi, a Cre gene expression cassette and a loxp sequence aresequentially inserted between the 192th base and the 5197th base to the 5' end of the adenovirus type 5 genome. The pIX gene expression cassette and the IVa2 gene expression cassette are inserted between the 27892th base and the 30991th base to the 5' end of the adenovirus type 5 genome. By adding the Cre gene, the expression of the Cre gene carried by the auxiliary virus is induced under the effect of the CRE enzyme of the packaging cell while removing the auxiliary virus packaging signal Psi, the amount of CRE enzyme is increased, and the packaging signal Psi is removed more thoroughly. Meanwhile, the genomic structure of the auxiliary virus is adjusted to avoid the recombination of the viral genome in the auxiliary virus and the packaging cell and the production of the wild type virus.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to an auxiliary adenovirus, in particular to an auxiliary adenovirus for improving the packing efficiency of high-capacity adenovirus. Background technique [0002] Currently in gene therapy, the most effective way to introduce foreign genes into target cells is through viral vectors. Commonly used viral vectors include adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, and the like. Adeno-associated virus vectors have the advantages of low immunogenicity and no random insertion into chromosomes, etc., but their capacity is too small, which limits their use. Lentiviral vectors are prone to cancer due to random insertion into chromosomes, and their safety has been questioned. Adenoviral vectors have the advantages of high capacity, high titer, and non-integration into chromosomes, etc., but their high immunogenicity can easily trigger a strong immune response during i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N7/01C12N15/61
CPCC12N7/00C12N9/90C12N2710/10021C12Y599/01
Inventor 夏海滨单琳琳朱贺张伟锋
Owner SHAANXI NORMAL UNIV