A helper adenovirus for improving the packaging efficiency of high-capacity adenoviruses
An adenovirus, high-efficiency technology, applied in the field of auxiliary adenovirus, can solve the problems of auxiliary adenovirus contamination, etc., and achieve the effect of avoiding wild-type virus, complete removal, and high purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Taking the helper adenovirus Ad helper1, which self-removes the packaging signal and has controllable expression of the pIX gene, as an example, the genome structure of the helper adenovirus is as follows:
[0024] Based on the type 5 adenovirus genome, the NCBI number of the type 5 adenovirus genome sequence is AC_000008. The DNA sequence between 193bp and 5196bp from the 5' end and the DNA sequence between 27893bp and 30990bp in the type 5 adenovirus genome were removed; the 192nd base and the 5197th base were removed from the 5' end of the type 5 adenovirus genome The loxp sequence, the adenovirus packaging signal Ψ, the Cre gene expression box, and the loxp sequence were inserted in sequence between the bases, and the direction of the two inserted loxp sequences was consistent; the 27892th base and the 30991st The pIX gene expression cassette and the IVa2 gene expression cassette were inserted between the bases.
[0025] The adenovirus packaging signal Ψ is placed ...
Embodiment 2
[0070] Taking the helper adenovirus Ad helper2, which self-removes the packaging signal and controls the expression of the pIX gene, as an example, the genome structure of the helper adenovirus is characterized by the fact that the N-terminal sequence of the Cre gene is a 4-base-long DNA at the 5' end of the Cre gene coding region. Fragment, the C-terminal sequence of the Cre gene is a 1049-base-long DNA fragment at the 3' end of the Cre gene coding region, and the adenovirus packaging signal is placed in reverse, and the distance between the 192nd base and the 5197th base at the 5' end of the adenovirus genome is The DNA sequence inserted between the bases is as follows:
[0071] ATAACTTCGTATAATGTATGCTATACGAAGTTATAAAACGCCAACTTTGACCCGGAACGCGGAAAACACCTGAGAAAAACACCTGGGCGAGTCTCCACGTAAACGGTCAAAGTCCCCGCGGCCCTAGACAAATATTACGCGCTATGAGTAACACAAAATTATTCAGATTTCACTTCCTCTTATTCAGTTTTCCCGCGAAAATGGCCAAATCTTACTCGGTTACGCCCAAATTTACTACAACATCCGCCTAAAACCGCGCGAAAATTGTCACTTCCTGTGTAAAACGCAAGAGTCTTCTCTGT...
Embodiment 3
[0074] Taking the helper adenovirus Ad helper3, which self-removes the packaging signal and controls the expression of the pIX gene, as an example, the genome structure of the helper adenovirus is characterized by the fact that the N-terminal sequence of the Cre gene is a DNA with a length of 1049 bases at the 5' end of the Cre gene coding region. Fragment, the C-terminal sequence of the Cre gene is a DNA fragment 4 bases long at the 3' end of the Cre gene coding region. The DNA sequence inserted between the bases is as follows:
[0075]ATAACTTCGTATAGCATACATTATACGAAGTTATAAAACGCCAACTTTGACCCGGAACGCGGAAAACACCTGAGAAAAACACCTGGGCGAGTCTCCACGTAAACGGTCAAAGTCCCCGCGGCCCTAGACAAATATTACGCGCTATGAGTAACACAAAATTATTCAGATTTCACTTCCTCTTATTCAGTTTTCCCGCGAAAATGGCCAAATCTTACTCGGTTACGCCCAAATTTACTACAACATCCGCCTAAAACCGCGCGAAAATTGTCACTTCCTGTGTAAAACGCAAGAGTCTTCTCTGTCTCGACAAGCCCAGTTTCTATTGGTCTCCTTAAACCTGTCTTGTAACCTTGATACTTACTCGCCATCTTCCAGCAGGCGCACCATTGCCCCTGTTTCACTATCCAGGTTACGGATATAGTTCATGACAATATTTACATTGGTCCAGC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


