Single-stranded circular RNA and DNA and preparation method and application thereof
A cyclic, single-chain technology, applied in the field of biomedicine, can solve the problems of inducing tumorigenesis, inactivation of tumor suppressor genes, difficulty in developing targeted drugs for tumor suppressor genes, etc., to promote apoptosis, inhibit proliferation, and resist tumors. and immunomodulatory effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Design and preparation method of single-stranded circular RNA (CSSR) or DNA (CSSD (single-stranded circular DNA)) that can adsorb miRNA (taking CSSD-9 as an example)
[0061] 1. Design of single-stranded circular DNA (CSSD-9) capable of adsorbing miRNA-9 (hsa-miR-9-5p)
[0062] Query the sequence of miRNA-9 through the microRNA database, and design according to the sequence of miRNA-9 two single-stranded nucleotide sequences (respectively marked as F strand and R strand) that are completely complementary or partially complementary to the end of the single-stranded circular DNA. ); by means of complementary bases at both ends, the two ends of the two single strands are combined into a circular structure, and the designed two single-stranded nucleotide sequences are divided into the following types:
[0063] 1) CSSD-9-F1 (contains two DNA sequences completely complementary to miRNA-9): GTTCAAACCGCTCATACAGCTGATAACCAAAGATTTTTCATACAGCT AGATAACCAAAGACCATCTTCAACAAT and CSSD-9-...
Embodiment 2
[0077] Anti-tumor effect and immunomodulatory effect of single-stranded circular RNA or DNA (taking CSSD-9 as an example)
[0078] 1. Detection of inhibitory effect on Hela and A549 cells
[0079] Compared with Lipofectamine 2000 (purchased from Shanghai Haoran Biotechnology Co., Ltd.) and Roche Transfection Reagent (purchased from Suzhou Saide Biotechnology Co., Ltd.), the nanosphere transfection reagent used in this paper is easier to operate and less harmful to cells. Small size and higher transfection efficiency at the same time, while the nanosphere transfection reagent has a unique slow-release effect, which fully meets the requirements for slow release of artificial circular DNA.
[0080] The Hela cells were subcultured, and 96-well plates were spread, and the nanospheres were transfected with linear miRNA inhibitor (LinearRNA-9), circular RNA-9 (circR-9), circular RNA-9, and shorter single-strand ( Circular DNA-9 (CSSD-9-s) formed by DNA formed by each single strand c...
Embodiment 3
[0091]Anti-tumor effects of single-stranded circular DNA designed according to a variety of cancer-promoting miRNAs (miRNA-190 (hsa-miR-190b), miRNA-21 (hsa-miR-21-5p), miRNA-17 (hsa- miR-17-5p), miRNA-10 (hsa-miR-10b-5p) as an example)
[0092] Referring to Example 2 and Example 3, the single-stranded circular DNA (respectively CSSD-190, CSSD-21, CSSD-17, CSSD-190, CSSD-21, CSSD-17, CSSD-10) to detect its effect on the proliferation, migration and invasion of Hela cells.
[0093] The nucleotide sequence of other miRNA-190 is 5'-UGAUAUGUUUGAUAUUGGGUU-3', and the two single-stranded nucleotide sequences that are complementary to the end of the single-stranded circular DNA (CSSD-190) that can absorb miRNA-190 are preferably :
[0094] CSSD-190-F1 (contains two DNA sequences completely complementary to miRNA-190): GCGGTTTGAACAACCCAATATCAAACATATCATTTTAACCCAATATCA AACATATCAATTGTTGAAGATGG and CSSD-190-R1 (contains two DNA sequences completely complementary to miRNA-190): GTTCAAACC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


