Single-stranded circular RNA and DNA and preparation method and application thereof
A cyclic, single-chain technology, applied in the field of biomedicine, can solve the problems of inducing tumorigenesis, inactivation of tumor suppressor genes, difficulty in developing targeted drugs for tumor suppressor genes, etc., to promote apoptosis, inhibit proliferation, and resist tumors. and immunomodulatory effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0059] Example 1:
[0060] Design and preparation method of single-stranded circular RNA (CSSR) or DNA (CSSD (single-stranded circular DNA)) that can adsorb miRNA (take CSSD-9 as an example)
[0061] 1. Design of single-stranded circular DNA (CSSD-9) that can adsorb miRNA-9 (hsa-miR-9-5p)
[0062] Query the sequence of miRNA-9 through the microRNA database. According to the sequence of miRNA-9, it is designed to prepare two single-stranded nucleotide sequences that are fully complementary or partially complementary to the ends of single-stranded circular DNA (labeled as F strand and R strand, respectively) ); The two ends of the two single-stranded strands are combined into a circular structure by complementing the bases at both ends. The designed two single-stranded nucleotide sequences are divided into the following types:
[0063] 1) CSSD-9-F1 (contains two DNA sequences that are fully complementary to miRNA-9): GTTCAAACCGCTCATACAGCTAGATAACCAAAGATTTTTCATACAGCT AGATAACCAAAGACCATCTTC...
Example Embodiment
[0076] Example 2
[0077] Study on the anti-tumor and immunomodulatory effects of single-stranded circular RNA or DNA (take CSSD-9 as an example)
[0078] 1. Detection of inhibitory effect on Hela and A549 cells
[0079] In this paper, the use of nanosphere transfection reagent, compared with Lipofectamine 2000 (purchased from Shanghai Haoran Biotechnology Co., Ltd.) and Roche transfection reagent (purchased from Suzhou Saide Biotechnology Co., Ltd.), the operation is simpler and more harmful to cells It is small and has higher transfection efficiency. Nano-microsphere transfection reagent has a unique slow-release effect, which fully meets the requirements for slow release of artificial circular DNA.
[0080] Subculture the Hela cells, spread 96-well plates, and transfect the nanospheres with linear miRNA inhibitors (LinearRNA-9), circular RNA-9 (circR-9), circular RNA-9, short single-stranded ( Each single strand can be complementary to one miRNA) circular DNA-9 (CSSD-9-s) formed b...
Example Embodiment
[0090] Example 3
[0091] Research on the anti-tumor effect of single-stranded circular DNA designed based on a variety of cancer-promoting miRNAs (with miRNA-190 (hsa-miR-190b), miRNA-21 (hsa-miR-21-5p), miRNA-17 (hsa- miR-17-5p), miRNA-10 (hsa-miR-10b-5p) as an example)
[0092] With reference to Example 2 and Example 3, transfected single-stranded circular DNA (CSSD-190, CSSD-21, CSSD-17, CSSD-10) to detect its effect on the proliferation, migration and invasion of Hela cells.
[0093] The nucleotide sequence of other miRNA-190 is 5'-UGAUAUGUUUGAUAUUGGGUU-3', and the two single-stranded nucleotide sequences complementary to the ends of the single-stranded circular DNA (CSSD-190) that can adsorb miRNA-190 are preferably :
[0094] CSSD-190-F1 (contains two DNA sequences that are fully complementary to miRNA-190): GCGGTTTGAACAACCCAATATCAAACATATCATTTTAACCCAATATCA AACATATCAATTGTTGAAGATGG and CSSD-190-R1 (contains two DNA sequences that are fully complementary to miRNA-190): GTTCAAACC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap