Unlock instant, AI-driven research and patent intelligence for your innovation.

Single-stranded circular RNA and DNA and preparation method and application thereof

A cyclic, single-chain technology, applied in the field of biomedicine, can solve the problems of inducing tumorigenesis, inactivation of tumor suppressor genes, difficulty in developing targeted drugs for tumor suppressor genes, etc., to promote apoptosis, inhibit proliferation, and resist tumors. and immunomodulatory effects

Inactive Publication Date: 2018-07-06
TIANLIKANG TIANJIN TECH CO LTD
View PDF6 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the mutation of tumor suppressor gene is random, any mutation, loss or insertion may lead to inactivation of tumor suppressor gene, loss of function, and induce tumorigenesis, so it is difficult to develop targeted drugs for a tumor suppressor gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single-stranded circular RNA and DNA and preparation method and application thereof
  • Single-stranded circular RNA and DNA and preparation method and application thereof
  • Single-stranded circular RNA and DNA and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Design and preparation method of single-stranded circular RNA (CSSR) or DNA (CSSD (single-stranded circular DNA)) that can adsorb miRNA (taking CSSD-9 as an example)

[0061] 1. Design of single-stranded circular DNA (CSSD-9) capable of adsorbing miRNA-9 (hsa-miR-9-5p)

[0062] Query the sequence of miRNA-9 through the microRNA database, and design according to the sequence of miRNA-9 two single-stranded nucleotide sequences (respectively marked as F strand and R strand) that are completely complementary or partially complementary to the end of the single-stranded circular DNA. ); by means of complementary bases at both ends, the two ends of the two single strands are combined into a circular structure, and the designed two single-stranded nucleotide sequences are divided into the following types:

[0063] 1) CSSD-9-F1 (contains two DNA sequences completely complementary to miRNA-9): GTTCAAACCGCTCATACAGCTGATAACCAAAGATTTTTCATACAGCT AGATAACCAAAGACCATCTTCAACAAT and CSSD-9-...

Embodiment 2

[0077] Anti-tumor effect and immunomodulatory effect of single-stranded circular RNA or DNA (taking CSSD-9 as an example)

[0078] 1. Detection of inhibitory effect on Hela and A549 cells

[0079] Compared with Lipofectamine 2000 (purchased from Shanghai Haoran Biotechnology Co., Ltd.) and Roche Transfection Reagent (purchased from Suzhou Saide Biotechnology Co., Ltd.), the nanosphere transfection reagent used in this paper is easier to operate and less harmful to cells. Small size and higher transfection efficiency at the same time, while the nanosphere transfection reagent has a unique slow-release effect, which fully meets the requirements for slow release of artificial circular DNA.

[0080] The Hela cells were subcultured, and 96-well plates were spread, and the nanospheres were transfected with linear miRNA inhibitor (LinearRNA-9), circular RNA-9 (circR-9), circular RNA-9, and shorter single-strand ( Circular DNA-9 (CSSD-9-s) formed by DNA formed by each single strand c...

Embodiment 3

[0091]Anti-tumor effects of single-stranded circular DNA designed according to a variety of cancer-promoting miRNAs (miRNA-190 (hsa-miR-190b), miRNA-21 (hsa-miR-21-5p), miRNA-17 (hsa- miR-17-5p), miRNA-10 (hsa-miR-10b-5p) as an example)

[0092] Referring to Example 2 and Example 3, the single-stranded circular DNA (respectively CSSD-190, CSSD-21, CSSD-17, CSSD-190, CSSD-21, CSSD-17, CSSD-10) to detect its effect on the proliferation, migration and invasion of Hela cells.

[0093] The nucleotide sequence of other miRNA-190 is 5'-UGAUAUGUUUGAUAUUGGGUU-3', and the two single-stranded nucleotide sequences that are complementary to the end of the single-stranded circular DNA (CSSD-190) that can absorb miRNA-190 are preferably :

[0094] CSSD-190-F1 (contains two DNA sequences completely complementary to miRNA-190): GCGGTTTGAACAACCCAATATCAAACATATCATTTTAACCCAATATCA AACATATCAATTGTTGAAGATGG and CSSD-190-R1 (contains two DNA sequences completely complementary to miRNA-190): GTTCAAACC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a single-stranded circular RNA and DNA, and a preparation method and application thereof, the single-stranded circular RNA and DNA can adsorb a single-stranded circularRNA or a single-stranded circular DNA of miRNA, thereby overcoming the disadvantage that a traditional single-stranded RNA is easily degraded and has low efficiency, and can release tumor suppressor gene ''co-silencing'' caused by the miRNA. The single-stranded circular RNA or DNA prepared by the method can specifically adsorb the target miRNA so as to inhibit the proliferation, migration and invasion of tumor cells and promote the apoptosis of the tumor cells, can regulate the proportion of immune cells, has good anti-tumor and immune regulation effects, and is expected to be developed as a therapeutic drug for tumors or immune diseases.

Description

technical field [0001] The present invention relates to the field of biomedicine, and more specifically, relates to a single-stranded circular RNA or circular DNA capable of absorbing miRNA, a preparation method thereof, and an application in the preparation of drugs for treating tumors or immune diseases. Background technique [0002] 1. Research on miRNA inhibitors [0003] MicroRNA (miRNA) is a kind of endogenous small RNA with a length of about 18-25 nucleotides, which has various important regulatory functions in cells. Mature miRNAs are produced by a series of nuclease cleavage and processing of longer primary transcripts, and then assembled into RNA-induced silencing complexes, which recognize target mRNAs through complementary base pairing, and according to the degree of complementarity Differently direct the silencing complex to degrade the target mRNA or to repress the translation of the target mRNA. Each miRNA can have multiple target genes, and several miRNAs c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/10A61K48/00A61K31/7088A61P35/00A61P37/02
CPCA61K31/7088C12N15/1135C12N2310/532
Inventor 杨诚孙涛陈双周红刚孟晶
Owner TIANLIKANG TIANJIN TECH CO LTD