Single-stranded circular RNA and DNA and preparation method and application thereof

A cyclic, single-chain technology, applied in the field of biomedicine, can solve the problems of inducing tumorigenesis, inactivation of tumor suppressor genes, difficulty in developing targeted drugs for tumor suppressor genes, etc., to promote apoptosis, inhibit proliferation, and resist tumors. and immunomodulatory effects

Inactive Publication Date: 2018-07-06
TIANLIKANG TIANJIN TECH CO LTD
View PDF6 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the mutation of tumor suppressor gene is random, any mutation, loss or insertion may lead to inactivation of tumor suppres

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single-stranded circular RNA and DNA and preparation method and application thereof
  • Single-stranded circular RNA and DNA and preparation method and application thereof
  • Single-stranded circular RNA and DNA and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0059] Example 1:

[0060] Design and preparation method of single-stranded circular RNA (CSSR) or DNA (CSSD (single-stranded circular DNA)) that can adsorb miRNA (take CSSD-9 as an example)

[0061] 1. Design of single-stranded circular DNA (CSSD-9) that can adsorb miRNA-9 (hsa-miR-9-5p)

[0062] Query the sequence of miRNA-9 through the microRNA database. According to the sequence of miRNA-9, it is designed to prepare two single-stranded nucleotide sequences that are fully complementary or partially complementary to the ends of single-stranded circular DNA (labeled as F strand and R strand, respectively) ); The two ends of the two single-stranded strands are combined into a circular structure by complementing the bases at both ends. The designed two single-stranded nucleotide sequences are divided into the following types:

[0063] 1) CSSD-9-F1 (contains two DNA sequences that are fully complementary to miRNA-9): GTTCAAACCGCTCATACAGCTAGATAACCAAAGATTTTTCATACAGCT AGATAACCAAAGACCATCTTC...

Example Embodiment

[0076] Example 2

[0077] Study on the anti-tumor and immunomodulatory effects of single-stranded circular RNA or DNA (take CSSD-9 as an example)

[0078] 1. Detection of inhibitory effect on Hela and A549 cells

[0079] In this paper, the use of nanosphere transfection reagent, compared with Lipofectamine 2000 (purchased from Shanghai Haoran Biotechnology Co., Ltd.) and Roche transfection reagent (purchased from Suzhou Saide Biotechnology Co., Ltd.), the operation is simpler and more harmful to cells It is small and has higher transfection efficiency. Nano-microsphere transfection reagent has a unique slow-release effect, which fully meets the requirements for slow release of artificial circular DNA.

[0080] Subculture the Hela cells, spread 96-well plates, and transfect the nanospheres with linear miRNA inhibitors (LinearRNA-9), circular RNA-9 (circR-9), circular RNA-9, short single-stranded ( Each single strand can be complementary to one miRNA) circular DNA-9 (CSSD-9-s) formed b...

Example Embodiment

[0090] Example 3

[0091] Research on the anti-tumor effect of single-stranded circular DNA designed based on a variety of cancer-promoting miRNAs (with miRNA-190 (hsa-miR-190b), miRNA-21 (hsa-miR-21-5p), miRNA-17 (hsa- miR-17-5p), miRNA-10 (hsa-miR-10b-5p) as an example)

[0092] With reference to Example 2 and Example 3, transfected single-stranded circular DNA (CSSD-190, CSSD-21, CSSD-17, CSSD-10) to detect its effect on the proliferation, migration and invasion of Hela cells.

[0093] The nucleotide sequence of other miRNA-190 is 5'-UGAUAUGUUUGAUAUUGGGUU-3', and the two single-stranded nucleotide sequences complementary to the ends of the single-stranded circular DNA (CSSD-190) that can adsorb miRNA-190 are preferably :

[0094] CSSD-190-F1 (contains two DNA sequences that are fully complementary to miRNA-190): GCGGTTTGAACAACCCAATATCAAACATATCATTTTAACCCAATATCA AACATATCAATTGTTGAAGATGG and CSSD-190-R1 (contains two DNA sequences that are fully complementary to miRNA-190): GTTCAAACC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention provides a single-stranded circular RNA and DNA, and a preparation method and application thereof, the single-stranded circular RNA and DNA can adsorb a single-stranded circularRNA or a single-stranded circular DNA of miRNA, thereby overcoming the disadvantage that a traditional single-stranded RNA is easily degraded and has low efficiency, and can release tumor suppressor gene ''co-silencing'' caused by the miRNA. The single-stranded circular RNA or DNA prepared by the method can specifically adsorb the target miRNA so as to inhibit the proliferation, migration and invasion of tumor cells and promote the apoptosis of the tumor cells, can regulate the proportion of immune cells, has good anti-tumor and immune regulation effects, and is expected to be developed as a therapeutic drug for tumors or immune diseases.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Owner TIANLIKANG TIANJIN TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products