Yeast genome editing carrier as well as construction method and applications thereof

A technology of genome editing and construction methods, applied in other methods of inserting foreign genetic materials, genetic engineering, biochemical equipment and methods, etc., can solve the problem that the positive clone rate of multi-site genome editing is not high, and strains cannot be edited again , Multi-site editing efficiency is low at the same time, to achieve the effect of multiple rounds of genome editing

Active Publication Date: 2018-08-10
SOUTH CHINA UNIV OF TECH
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a yeast genome editing method using CRISPR/Cas9 as the core. This genome editing technology solves the problem of the low efficiency of simultaneous editing of multiple sites in the general CRISPR/Cas9 technology and the inability of strains with modified genom

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast genome editing carrier as well as construction method and applications thereof
  • Yeast genome editing carrier as well as construction method and applications thereof
  • Yeast genome editing carrier as well as construction method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Construction of Yeast Genome Editing Universal Vector

[0027] Using Addgene's commercialized plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t (referred to as P426) as the starting vector, the same LoxP sequence (SEQ ID NO: 1) was introduced at both ends of the Ori site of the vector, and at P426 The KpnI site is integrated into the complete recombinase Cre expression cassette. The specific implementation is as follows:

[0028] 1. Introduction of LoxP sequences at both ends of the replication origin site Ori

[0029] Using the P426 vector as a template, the LoxP1 fragment was amplified with the P1 (5'-TCGTATAGCATACATTATACGAAGTTATACTTATATGCGTCTATTTATGT AG-3') / P2(5'-GTATAGCATACATTATACGAAGTTATTCCCCCGAAAAGTGCCACCTGA-3') primer pair. II Recombination Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.), the plasmid P426-LoxP1 was obtained by recombining and circularizing LoxP1 itself.

[0030] Further, using P426-LoxP1 as a template, the LoxP2 fragment was obtained by a...

Embodiment 2

[0038] use II recombination cloning kit will PCR product gene fragment P GAL1 -Cre-T CYC1 Homologous recombination with KpnI linearized P426-LoxP to obtain the yeast genome editing universal vector p426-CL. Example 2 Knockout of Geranylgeranyl pyrophosphate synthase (Geranylgeranyl pyrophosphate synthase, BTS1) and transcriptional regulatory gene (Heme-dependent repressor of hypoxic genes, ROX1) gene in Saccharomyces cerevisiae genome

[0039] The vector P426-CL constructed in Example 1 was used as the gRNA expression vector to construct the backbone to realize the knockout of the BTS1 and ROX1 genes in the yeast genome.

[0040] 1. PCR amplification of bts1-gRNA and rox1-gRNA expression vector fragments

[0041] Using P426-CL as a template, P13(5′-TAATAATGGTTTCTAGTATGA-3′) / P14(5′-AACAGGATCATTATTGATCAGATCATTTATTCTTACTGC-3′) and P15(5′-TGATCAATAATGATCCTGTTGTTTTGAGCTAGAAATA-3′) / P16(5′-ACTAAGAAAACCATTATTATCAT-3 ') is a pair of primers, respectively amplified to obtain fragme...

Embodiment 3

[0054] Example 3 Saccharomyces cerevisiae S.cerevisiae BJ5464ΔBTS1ΔROX1 genome ERG9 gene, ypl062w gene and yjl064w gene editing

[0055] The P426-CL constructed in Example 1 was used as a template as a gRNA expression vector to construct the backbone to realize the editing of the yeast genome ERG9 gene, yp1062w gene and yjl064w gene.

[0056] 1. Loss of carrier P426-CL-BTS1-ROX1 in S. cerevisiae BJ5464ΔBTS1ΔROX1 / P426-CL-BTS1-ROX1 cells

[0057] Pick a single colony of S.cerevisiae BJ5464ΔBTS1ΔROX1 / P426-CL-BTS1-ROX1 and inoculate it in SG / ΔTrp liquid medium (galactose 20.0g / L, DO Supplement 0.62g / L, amino-free yeast nitrogen source YNB 6.7g / L , Ura 0.02g / L, Leu0.06g / L), cultivated at 30°C and 220rpm for 36h. Dilute the bacterial solution to 10 6 After doubling and spread on SD / ΔTrp solid plate containing 1g / L 5-FOA (glucose 20.0g / L, agar 20.0g / L, DO Supplement 0.62g / L, amino-free yeast nitrogen source YNB 6.7g / L , Ura 0.02g / L, Leu 0.06g / L), cultivated at 30°C for 36h, passed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a yeast genome editing carrier as well as a construction method and applications of the yeast genome editing carrier. According to the technical scheme, a gRNA coding plasmid Pis adopted as a starting carrier, LoxP sequences of 34bp in the same direction are introduced at two ends of the replication initial point Ori of the carrier, a Cre recombinase gene expression box isintroduced at the skeleton position of the plasmid P, and thus the yeast genome editing carrier is obtained. The carrier is applied in gene editing adopting CRISPR/Cas9 as the medium, and the efficient and multi-round editing for the saccharomyces cerevisiae genome can be realized.

Description

technical field [0001] The invention relates to a method for genome editing of Saccharomyces cerevisiae and its application. The editing method utilizes a universal vector capable of self-loss, combined with the CRISPR / Cas9 system, to achieve efficient and convenient editing of the Saccharomyces cerevisiae genome. Background technique [0002] With the rapid development of molecular biology, a variety of genome editing technologies that can realize precise editing of organism genomes have emerged one after another. This technology mainly utilizes sequence specific nuclease (SSN), which is a combination of sequence-specific DNA binding domain and non-specific DNA modification domain, to cut double-stranded DNA in a specific position in the genome. Then activate the cell's own repair function to achieve directional transformation such as gene knockout, site-specific insertion or replacement. [0003] At present, the gene editing technologies mainly include: zinc finger nucle...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/90C12N9/22
CPCC12N9/22C12N15/905C12N15/81C12N15/102C12N2310/20
Inventor 李爽陈和锋朱晁谊朱牧孜
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap