Application of protein tanrt2.5 in regulation of plant yield
A technology of tanrt2.5 and 1.tanrt2.5 is applied in the application field of protein TaNRT2.5 in regulating plant yield, which can solve the problems of low fertilizer utilization rate, affecting wheat yield and quality, soil compaction, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Embodiment 1, the construction of transgenic TaNRT2.5 wheat
[0058] 1. Preparation of transgenic TaNRT2.5 plants
[0059] (1) Acquisition of TaNRT2.5 gene
[0060] 1. The total RNA of wheat variety Longchun 23 was extracted, and its genome cDNA was obtained by reverse transcription.
[0061] 2. Use the cDNA obtained in step 1 as a template, and use the following primers as primers to perform PCR amplification to construct the sequence required for overexpressing the TaNRT2.5-3B transgenic line wheat:
[0062] TaNRT2.5-OE-F: 5'- GGATCC ATGGAGGGGGAGTCGAAGCC-3' (the underlined sequence is the recognition site for BamHI digestion);
[0063] TaNRT2.5-OE-R: 5'- GGTACC TCAATGGTGATGGTGATGATGCACGTCGGCCGG CGACC-3' (the sequence indicated by the underline is the recognition site for KpnI enzyme digestion).
[0064] Use the following primers as primers to perform PCR amplification to construct the sequence required for down-expression TaNRT2.5 transgenic line wheat:
[006...
Embodiment 2
[0110] Example 2, Detection of yield traits of TaNRT2.5 transgenic wheat
[0111] 1. Detection method of yield traits
[0112] Tested wheat: two T3 generation TaNRT2.5-3B overexpressed wheat OE102-6 and OE103-1, two TaNRT2.5 downexpressed wheat R100-1 and R109-2, wild type wheat Longchun 23, and empty control plants.
[0113] The determination of wheat yield-related traits was carried out under field conditions, and the planting site was the Embankment Experimental Station of Hebei Academy of Agriculture and Forestry Sciences. The specific steps were as follows:
[0114] In each plot, the seeds of each tested wheat are sown in 2 rows, 4 repetitions, the row length is 2m, and the plant spacing is 5cm. After the wheat is mature, the following indicators of each tested wheat are measured: grain yield per plant (g / plant), number of panicles per panicle, number of grains per panicle, thousand-grain weight (g) and biomass per plant (dry weight).
[0115] The results are shown in ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com