Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of protein tanrt2.5 in regulation of plant yield

A technology of tanrt2.5 and 1.tanrt2.5 is applied in the application field of protein TaNRT2.5 in regulating plant yield, which can solve the problems of low fertilizer utilization rate, affecting wheat yield and quality, soil compaction, etc.

Active Publication Date: 2020-10-27
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, with the improvement of people’s living standards, the society’s demand for high-quality special-purpose wheat is increasing, and the planting area of ​​high-quality wheat has increased rapidly. The quality and stability of batch commercial wheat put forward higher and higher requirements. In order to produce wheat with high protein content, unreasonable application of chemical fertilizers will not only lead to soil compaction, low fertilizer utilization rate, but also serious loss and pollution, which will cause huge It affects the yield and quality of wheat, and is more harmful to the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein tanrt2.5 in regulation of plant yield
  • Application of protein tanrt2.5 in regulation of plant yield
  • Application of protein tanrt2.5 in regulation of plant yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1, the construction of transgenic TaNRT2.5 wheat

[0058] 1. Preparation of transgenic TaNRT2.5 plants

[0059] (1) Acquisition of TaNRT2.5 gene

[0060] 1. The total RNA of wheat variety Longchun 23 was extracted, and its genome cDNA was obtained by reverse transcription.

[0061] 2. Use the cDNA obtained in step 1 as a template, and use the following primers as primers to perform PCR amplification to construct the sequence required for overexpressing the TaNRT2.5-3B transgenic line wheat:

[0062] TaNRT2.5-OE-F: 5'- GGATCC ATGGAGGGGGAGTCGAAGCC-3' (the underlined sequence is the recognition site for BamHI digestion);

[0063] TaNRT2.5-OE-R: 5'- GGTACC TCAATGGTGATGGTGATGATGCACGTCGGCCGG CGACC-3' (the sequence indicated by the underline is the recognition site for KpnI enzyme digestion).

[0064] Use the following primers as primers to perform PCR amplification to construct the sequence required for down-expression TaNRT2.5 transgenic line wheat:

[006...

Embodiment 2

[0110] Example 2, Detection of yield traits of TaNRT2.5 transgenic wheat

[0111] 1. Detection method of yield traits

[0112] Tested wheat: two T3 generation TaNRT2.5-3B overexpressed wheat OE102-6 and OE103-1, two TaNRT2.5 downexpressed wheat R100-1 and R109-2, wild type wheat Longchun 23, and empty control plants.

[0113] The determination of wheat yield-related traits was carried out under field conditions, and the planting site was the Embankment Experimental Station of Hebei Academy of Agriculture and Forestry Sciences. The specific steps were as follows:

[0114] In each plot, the seeds of each tested wheat are sown in 2 rows, 4 repetitions, the row length is 2m, and the plant spacing is 5cm. After the wheat is mature, the following indicators of each tested wheat are measured: grain yield per plant (g / plant), number of panicles per panicle, number of grains per panicle, thousand-grain weight (g) and biomass per plant (dry weight).

[0115] The results are shown in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of protein TaNRT2.5 in controlling a plant yield. The invention provides application of TaNRT2.5 protein or a related biological material in controlling the plant yield. The related biological material is an expression box which can express a nucleic acid molecule of the TaNRT2.5 protein or contains the nucleic acid molecule, a recombinant vector, a recombinantbacteria or a transgenic cell system. The protein TaNRT2.5 provided by the invention can increase the plant yield; compared with the wild type plant, the TaNRT2.5-3B excessively express the single-plant grain yield of the transgenic plant, spike number of each plant and single-plant biological amount, which are remarkably increased; and the TaNRT2.5 expresses the single-plant grain yield of the transgenic plant, spike number of each plant and single-plant biological amount in a reduced mode, which are remarkably reduced. Therefore, the protein TaNRT2.5 can be utilized to control the plant yield. The invention has very important application value for breeding a novel high-yield plant material.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of protein TaNRT2.5 in regulating plant yield. Background technique [0002] Wheat is one of the three major grains, and almost all of it is used for food, and only about one-sixth is used as feed. Mesopotamia is the first area in the world to cultivate wheat, and China is one of the earliest countries in the world to plant wheat. In 2010, wheat was the food crop with the second largest output in the world (651 million tons), second only to corn (844 million tons). About 40% of the population uses wheat as the staple food. Wheat is rich in nutrients and can be ground into Flour can be used to make steamed buns, bread, biscuits and other foods. [0003] Wheat has high nutritional value, and the B vitamins and minerals contained in it are very beneficial to human health. In recent years, with the improvement of people’s living standards, the society’s demand for high...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8261
Inventor 童依平李文静何雪赵学强滕婉马文英
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More