Recombinant bacillus subtilis for synthesizing lactyl-N-neotetraose and construction method and application of recombinant bacillus subtilis

A technology of Bacillus subtilis and construction method, which is applied in the direction of recombinant DNA technology, bacteria, and the introduction of foreign genetic material using vectors, etc. It can solve the problems of inapplicability of toxic solvents, low synthesis yield, cumbersome protection, deprotection operation, separation and purification, etc. question

Inactive Publication Date: 2018-08-17
BRIGHT DAIRY & FOOD
View PDF4 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the currently developed chemical synthesis requires cumbersome protection, deprotection operations and a large number of separation and purification work, and the overall synthesis yield is low; in terms of enzymatic synthesis, the source of the enzyme and the strict substrate adaptability of the enzyme limit its use in oligosaccharides. It is used in a large number of synthetic applications, and the use of toxic solvents in its extraction process is not suitable for the production of nutraceuticals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis for synthesizing lactyl-N-neotetraose and construction method and application of recombinant bacillus subtilis
  • Recombinant bacillus subtilis for synthesizing lactyl-N-neotetraose and construction method and application of recombinant bacillus subtilis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Construction of recombinant fragments

[0025] Using the Bacillus subtilis (Bacillus subtilis 168) genome as a template, according to the amyE gene (Gene ID: 938356) published on NCBI, the primers for the homology arms on both sides were designed, and the sequences were SEQ ID NO: 1 and SEQ ID NO: 2 Left homology arm primer:

[0026] amyE-1F:5'-TATTCCGTATGTCAAGTGGCTGCGGTTTAT-3' (SEQ ID NO: 1),

[0027] amyE-1R:5'- AATTGTTATCCGCTCTCTTGACACTCCTTATTTGA TTTTTTGAAGACTTACTTCGG-3' (SEQ ID NO: 2),

[0028] The sequences are respectively the right homology arm primers of SEQ ID NO:3 and SEQ ID NO:4:

[0029] amyE-2F:5'- CTTAAGGGCAAGGCTAGACGGGACTTA -3' (SEQ ID NO: 3),

[0030] amyE-2R:5'-GGCACACCGATGTACACGTCATC-3' (SEQ ID NO:4),

[0031] Use the above primers to amplify the homology arm gene sequences on both sides of amyE from the Bacillus subtilis genome; use the plasmid pP43NMK as a template to design primers whose sequences are SEQ ID NO:5 and SEQ ID NO:6:...

Embodiment 2

[0044] Example 2 Construction of recombinant plasmids

[0045] According to the β-1,3-N-glucosaminyltransferase gene lgtA (Gene ID: 904226) in Neisseria meningitidis MC58 published on NCBI, after codon optimization by Bacillus subtilis, synthesize as the gene sequence shown in SEQ ID NO:14, CTGCCGGAAGAAGATTTTGAAAGAGCAAGACGCTTTCTTTACCAATGTTTTAAACGCACAGATACATTACCGGCTGGCGCCTGGCTGGATTTTGCAGCGGATGGAAGAATGAGACGCTTATTTACACTGCGCCAGTACTTTGGAATCCTGCATAGACTGCTGAAAAACCGCTAA (SEQ ID NO: 14)

[0046] The primers whose sequences are respectively designed as SEQ ID NO:15 and SEQ ID NO:16:

[0047] lgtA-1F:5'- ATGCCGTCTGAAGCTTTTAG ACGC-3' (SEQ ID NO: 15),

[0048] lgtA-1R:5'- TTAGCGGTTTTTCAGCAGTC TATGCAGGATT-3' (SEQ ID NO: 16),

[0049] Using the above primers, the lgtA gene fragment was amplified using the synthetic β-1,3-N-glucosaminyltransferase gene (SEQ ID NO: 14) as a template.

[0050] According to the β-1,4-galactosyltransferase gene lgtB (Gene ID: 904227) in Neisseria mening...

Embodiment 3

[0059] Example 3 Construction of Recombinant PZL Fragment Bacillus subtilis

[0060] The constructed recombinant fragment PZL was transformed into Bacillus subtilis competent cells (Bacillus subtilis168), the amount of recombinant fragment added was 100-300ng, electroporation conditions: voltage 2.5kV, electroporation reagent 5ms, 37°C recovery for 5h, and then coated with Bleomyces Incubate at 37°C for 24 hours. Using lacY-F and lacY-R primers (shown in SEQ ID NO:9 and SEQ ID NO:10 respectively) to select transformants for colony PCR verification, a 1295bp band appeared, and it was verified that the recombinant Bacillus subtilis mA0 was obtained.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides recombinant bacillus subtilis for synthesizing lactyl-N-neotetraose. The recombinant bacillus subtilis is integrated with lactose permease genes in a recombinant manner on bacillus subtilis 168 genome and converts plasmids which contain beta-1,3-N-glucoaminotransferase genes and beta-1,4-galactosyltransferase gene in bacillus subtilis 168. Uridine diphosphate galactose and acetylglucosamine uridine diphosphate in a metabolic pathway of the bacillus subtilis are used as precusor substances, lactose only needs to be added exogenously and is transferred into cells under theeffect of lactamase to synthesize the lactyl-N-neotetraose which is secreted to ectoenzyme. The accumulation amount of the lactyl-N-neotetraose synthesized by the recombinant bacillus subtilis reaches 1071 mg / L, and a foundation is laid for production of the lactyl-N-neotetraose through further metabolic engineering modified bacillus subtilis.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant Bacillus subtilis for synthesizing lactoyl-N-neotetrasaccharide and its construction method and application. Background technique [0002] Human Milk Oligosaccharides (Human Milk Oligosaccharides MOs) is the third largest solid component in human breast milk, second only to lactose and fat. Since HMOs cannot be decomposed in the mouth and small intestine, HMOs are important prebiotics that can be utilized by the beneficial microbial flora in the intestinal tract to promote the proliferation of bifidobacteria, hinder the adhesion of pathogens, regulate the response of intestinal epithelial cells, immune regulation, etc. So far, HMOs including lactoyl-N-neotetraose have been applied in infant formula and food additives in clinical trials. Starting from lacto-N-neotetraose, further fucosyl or sialyl oligosaccharides can be obtained by fucosyla...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/75C12P19/18C12P19/26
CPCC12N15/75C12P19/18C12P19/26
Inventor刘龙王淼陈坚堵国成李江华董晓敏
OwnerBRIGHT DAIRY & FOOD