Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer pair, kit containing same, use and method for detecting ecotypes a17 and r108 of Medicago truncatula

An R108, eco-type technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of loss of gene function research of Medicago truncatula, inaccurate results, and difficulty in distinguishing

Active Publication Date: 2021-05-14
LANZHOU UNIVERSITY
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The seeds of these two ecotypes are very similar in appearance and shape, and it is very difficult to distinguish them. Once they are mixed, it will cause irreparable losses to the research on the gene function of Medicago truncatula. At present, there is no unified and effective identification at home and abroad. method
Can only rely on naked eye observation, so the results are not accurate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair, kit containing same, use and method for detecting ecotypes a17 and r108 of Medicago truncatula
  • Primer pair, kit containing same, use and method for detecting ecotypes a17 and r108 of Medicago truncatula
  • Primer pair, kit containing same, use and method for detecting ecotypes a17 and r108 of Medicago truncatula

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1 A kind of primer pair that detects Medicago truncatula ecotype A17 and R108

[0054] The present embodiment provides a detection of Medicago truncatula ecotypes A17 and R108, the primer pair includes primer NST480-F and primer NST480-R, wherein, primer NST480-F has the sequence shown in SEQ ID NO.1, and primer NST480- R has the sequence shown in SEQ ID NO.2.

[0055] NST480-F (5′-3′): GGAGAACAATGAGAACAACAATG

[0056] NST480-R (5'-3'): GACCACCATCACCACATGC

Embodiment 2

[0057] Example 2 A test kit for detecting Medicago truncatula ecotypes A17 and R108

[0058] This embodiment provides a test kit for detecting Medicago truncatula ecotypes A17 and R108, which includes the following components: primer NST480-F and primer NST480-R, 2×PCR Master and ddH 2 O;

[0059] 2×PCR Master contains 3mM MgCl 2 , 0.2mM dNTP, 0.1U / μl Taq and 2×PCR Buffer.

Embodiment 3

[0060] Embodiment 3 A kind of method for distinguishing the seeds of Medicago truncatula ecotype A17 and R108

[0061] The present embodiment provides a kind of method of identifying the seed of Medicago truncatula ecotype A17 and R108, and the method comprises the steps:

[0062] A) Collect the seeds of different mutant types of Medicago truncatula ecotypes A17 and R108, adopt the double-layer filter paper germination method, germinate at 25°C for 72 hours, and extract the genomic DNA of the germinated seeds by the SDS method for future use;

[0063] B) using primer NST480-F and primer NST480-R to perform PCR amplification on the genomic DNA extracted in step A);

[0064] The PCR amplification system is a 20 μl system, including 10 μl of TaKaRa 2×PCR TaqMix, 1 μl of DNA template with a concentration of 50 ng / μl, 1 μl of primer NST480-F with a concentration of 10 nM, 1 μl of primer NST480-R with a concentration of 10 nM and ddH 2 O 7 μl;

[0065] PCR amplification program: a) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a pair of primers, a kit containing the same, a use and a method for detecting ecotypes A17 and R108 of Medicago truncatula, and relates to the field of biotechnology. The primer pair comprises primer NST480‑F and primer NST480‑R, which have the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, and can simultaneously amplify DNA fragments of different fragment lengths of Medicago truncatula ecotypes A17 and R108 , so one amplification can distinguish whether the test sample contains Medicago truncatula ecotypes A17 and R108. Using the above primers to detect Medicago truncatula ecotypes A17 and R108 has the characteristics of strong sensitivity, high accuracy, strong repeatability, fast and convenient, and alleviates the lack of a fast and accurate method for detection and identification in the prior art. Problems with Medicago truncatula ecotypes A17 and R108.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer pair, a kit containing the same, use and a method for detecting the ecotypes A17 and R108 of Medicago truncatula. Background technique [0002] Medicago truncatula (Medicago truncatula), as a legume model plant, has the characteristics of drought tolerance, cold and heat tolerance, high yield and high quality, and can improve soil at the same time. It also has short growth cycle, small genome, high genetic transformation rate and self-pollination. advantage. Medicago truncatula, most legumes including Medicago sativa (M. sativa), are genetically similar. The information obtained from Medicago truncatula can be borrowed for other legumes. Therefore, Medicago truncatula has attracted much attention in plant molecular biology and genomics research. [0003] With the development of animal husbandry, the demand for forage grass is increasing, and the safety requirements are al...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895
Inventor 闫龙凤申书恒刘志鹏罗栋王彦荣
Owner LANZHOU UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com