30results about How to "Help to distinguish" patented technology

The invention mainly relates to a method for identifying authenticity of a medicago sativa seed and special primers thereof, in particular to a gene detection kit of medicago sativa and melilotus albus and a detection method thereof. The kit for identifying the authenticity of the medicago sativa seed is mainly characterized in that: the total volume of a medicago sativa PCR (Polymerase Chain Reaction) detection system is 20 mul; and the kit comprises 2*PCR Master, the special primer MsITS-F (5'-3'): TTTTTGAACGCAAGTTGCGC and the special primer MsITS-R (5'-3'): CAACCAACCACGAGACAGA and ddH2O. Detection result shows that the technology can be used for identifying the authenticity of the medicago sativa seed, has the characteristics of high sensitivity, high accuracy, high repeatability, quickness, convenience and the like, has broad application prospect in medicago sativa industrial promotion of China, can guarantee that the production of livestock husbandry of China is served by the medicago sativa well and lays a solid foundation for guaranteeing grain safety of China.

The invention provides a mobile Internet user access mode representing and clustering method. The method comprises that a domain name access sequence of mobile Internet users is acquired; preprocessing is performed on the mobile Internet domain name user access sequence, and training data and actual data of a preset data type are generated; a vector representation training module performs trainingon a training data set by using an algorithm; a user vector generation module performs generation calculation on the actual data by using a training model acquired by the training algorithm; APP domain name classification rules are set, and manual classification is performed according to belonging fields and purposes of domain names in the domain name access sequence; and a user vector clusteringmodule performs clustering and analysis on users by using an acquired user vector. The mobile Internet user clustering method provided by the invention is based on domain name access sequence data ofthe users, clustering for the users is achieved, and behavioral habits and characteristics of the users are extracted.

The invention provides a terminal information acquisition method and device. The method comprises steps that if the device information of an SIM card binding terminal changes, the association information of an SIM card is acquired according to an identity identifier of the SIM card; the association information is synchronized to a present binding terminal of the SIM card. The method is advantagedin that when the device information of the SIM card binding terminal changes, for example, the SIM card is transferred to a new terminal, or the present binding terminal of the SIM card performs factory reset operation, the present binding terminal of the SIM card has not any of the relevant information of the SIM card, the association information of the SIM card can be automatically acquired by the present binding terminal of the SIM card according to the identity identifier of the SIM card, and the association information is locally synchronized. Compared with the prior art, the informationis acquired without manual operation of a user, the intelligent degree of the user terminal is improved.

The invention discloses an inter-satellite laser interference frequency planning simulation verification system for time sequence reinforcement learning. The system comprises a laser interference optical platform group, a storage assembly and a display terminal, wherein the laser interference optical platform group comprises six laser interference optical platforms with the same structure, every two laser interference optical platforms form a pair, the frequency and the phase of laser are adjusted in real time according to a frequency planning scheme, and frequency shift is carried out on incident laser according to Doppler interference frequency information, so that the interference of the satellite in the space due to the Doppler phenomenon is simulated; the storage component is used for storing a pre-established and trained decision model, a frequency planning scheme determined by the decision model and Doppler interference frequency information corresponding to each moment of an experiment, and storing a frequency planning scheme selected in the experiment; the decision model is obtained by training through a time sequence backtracking reinforcement learning method; and the display terminal is used for displaying the Doppler interference frequency information and the laser beat frequency information in real time.

The invention relates to a passive human body identification method based on narrowband radio frequency link sampling. The method comprises the following steps: collecting biological characteristic information generated by walking of a pedestrian to be identified through a plurality of radio frequency links, matching the biological characteristic information with a radio frequency signal receivingintensity sequence, fusing the radio frequency signal receiving intensity sequences of all the radio frequency links to obtain a fused radio frequency signal receiving intensity value vector; carrying out maximum likelihood probability estimation matching on the fusion radio frequency signal receiving intensity value vector and each Gaussian mixture model in an identity database, and carrying outidentity recognition on the to-be-recognized pedestrian according to an output probability value. According to the invention, biological characteristic information generated by walking of a pedestrian to be identified is sampled and acquired through the constructed multi-angle interleaved radio frequency links; forced cooperation and visual privacy invasion of a user in a limited environment areeffectively avoided, the dependence of correct recognition on illumination and different wearing clothes is remarkably reduced, and the advantages of being free of invasion, difficult to hide, difficult to camouflage and the like are achieved.

The invention discloses a Chinese address compound word segmentation technology based on rules and a statistic model. The word segmentation processing is carried out on addresses by comprehensively utilizing a condition random field model and a maximum matching algorithm optimized by the rules; and the condition random field model extracts related characteristics of address inner information, and a training data set established by a pre-processing phase to train the model so that the Chinese address compound word segmentation technology has the capabilities of automatically segmenting address information and identifying address factors. The condition random field model has a strong model identification capability and can be used for successfully identifying cells with database omission, and also has a good ambiguous address identification capability so that the address factors can be successfully distinguished. An MMSEG algorithm has the characteristics of rapid speed, high precision and the like under the good condition of dictionary data support. According to the Chinese address compound word segmentation technology, the two algorithms are combined and can be mutually supplemented and identified, so that the address matching accuracy is effectively improved, and the word segmentation accuracy is improved under the condition that the efficiency is guaranteed.

The invention provides a primer pair, a kit comprising the same, application of the primer pair and a method for detecting medicago truncatula ecotypic A17 and R108 and relates to the field of biotechnology. The primer pair comprises a primer NST480-F and a primer NST480-R, which have sequences separately shown as SEQ ID NO.1 and SEQ ID NO.2 and meanwhile can simultaneously amplify DNA (deoxyribonucleic acid) fragments of different lengths of the medicago truncatula ecotypic A17 and R108, so that a user can distinguish whether a sample to be detected contains the medicago truncatula ecotypic A17 and R108 through one amplification. When applied to detecting the medicago truncatula ecotypic A17 and R108, the primer pair has the advantages of being high in sensitivity, accuracy and repeatability, rapid, convenient and the like and solves the problem that the prior art lacks a rapid and accurate method for detecting and identifying the medicago truncatula ecotypic A17 and R108.

The invention provides a liquid detection device and method. The liquid detection device comprises: a pulse light source configured to emit pulse light; a time domain dispersion device configured to convert the pulse light emitted by the pulse light source from a frequency domain to a time domain to form pulse light after time domain broadening; a first spatial dispersion device configured to change the propagation direction of the light with different frequencies in the pulse light after time domain broadening in space; a first objective lens configured to converge the pulse light of which the propagation direction is changed by the first spatial dispersion device to a micro-flow device; the micro-flow device configured to enable a to-be-detected liquid in the micro-flow device to flow ata preset speed; a second objective lens configured to collect the light which is converged by the first objective lens and passes through the micro-flow device; a second spatial dispersion device forspatially recombining the light collected by the second objective lens; and a photoelectric detection device configured to image the light recombined by the second spatial dispersion device so as todetect the micro particles in the liquid.

The invention relates to the field of intelligent manufacturing of automotive electronics, in particular to a U-shaped assembly line for intelligent manufacturing of automotive electronics. The U-shaped assembly line comprises a feeding unit, an ICT test unit, a program burning unit, a sensitivity test unit, an assembling unit, a finished product function test unit and a packing unit, wherein theunits are arranged in a U shape according to production processes and transmitted through a conveyer belt. The assembly line is built by adoption of lean pipes, a cell ideal is fused; manual transferis matched with belt transfer, workers stand to carry out operation, and automatic processes are adopted, so that the labor demand can be greatly reduced, the production efficiency can be improved, the degree of dependency, on operation levels of operators, of product quality can be reduced at the same time; the completion effect of each process is automatically detected, so that the detection efficiency and detection result errors can be improved; an unqualified product placing box is set to be red, so that the operators can distinguish the unqualified products and the probability of mixing unqualified products into qualified products can be greatly reduced; and through setting a barcode fool-proof device for each unit, non-detected products at upper stations can be effectively preventedfrom flowing into lower stations.

The invention provides a visual field compensation method for near-eye display equipment, the near-eye display equipment is provided with a camera and a display screen, and the method comprises the following steps: S101: collecting an image around a wearer of the near-eye display equipment through the camera; s102, determining a reduced actual display area on the display screen according to the field of view of the wearer; and S103, reducing the image and displaying the image in the actual display area. The invention further provides near-to-eye display equipment capable of executing the method, the visual ability of the low-vision user with the incomplete visual field can be improved or improved, and the visual field range is expanded.