Primer pair, kit comprising same, application of primer pair and method for detecting medicago truncatula ecotypic A17 and R108
An R108, eco-type technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of loss of gene function research of Medicago truncatula, inaccurate results, difficulty in distinguishing, etc., to achieve repeatability Fast and convenient, highly sensitive and repeatable effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1 A kind of primer pair that detects Medicago truncatula ecotype A17 and R108
[0054] The present embodiment provides a detection of Medicago truncatula ecotypes A17 and R108, the primer pair includes primer NST480-F and primer NST480-R, wherein, primer NST480-F has the sequence shown in SEQ ID NO.1, and primer NST480- R has the sequence shown in SEQ ID NO.2.
[0055] NST480-F (5′-3′): GGAGAACAATGAGAACAACAATG
[0056] NST480-R (5'-3'): GACCACCATCACCACATGC
Embodiment 2
[0057] Example 2 A test kit for detecting Medicago truncatula ecotypes A17 and R108
[0058] This embodiment provides a test kit for detecting Medicago truncatula ecotypes A17 and R108, which includes the following components: primer NST480-F and primer NST480-R, 2×PCR Master and ddH 2 O;
[0059] 2×PCR Master contains 3mM MgCl 2 , 0.2mM dNTP, 0.1U / μl Taq and 2×PCR Buffer.
Embodiment 3
[0060] Embodiment 3 A kind of method for distinguishing the seeds of Medicago truncatula ecotype A17 and R108
[0061] The present embodiment provides a kind of method of identifying the seed of Medicago truncatula ecotype A17 and R108, and the method comprises the steps:
[0062] A) Collect the seeds of different mutant types of Medicago truncatula ecotypes A17 and R108, adopt the double-layer filter paper germination method, germinate at 25°C for 72 hours, and extract the genomic DNA of the germinated seeds by the SDS method for future use;
[0063] B) using primer NST480-F and primer NST480-R to perform PCR amplification on the genomic DNA extracted in step A);
[0064] The PCR amplification system is a 20 μl system, including 10 μl of TaKaRa 2×PCR TaqMix, 1 μl of DNA template with a concentration of 50 ng / μl, 1 μl of primer NST480-F with a concentration of 10 nM, 1 μl of primer NST480-R with a concentration of 10 nM and ddH 2 O 7 μl;
[0065] PCR amplification program: a) ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



