Unlock instant, AI-driven research and patent intelligence for your innovation.

EV-D68 (enterovirus-D68) and application of EV-D68 to preparation of EV-D68 infected animal

A technology of EV-D68 and enterovirus, applied in the preparation of new enterovirus EV-D68 virus infection animal model, in the field of enterovirus 68, can solve the problem of no challenge virus strains appearing

Active Publication Date: 2018-08-21
NAT INST FOR FOOD & DRUG CONTROL
View PDF14 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Alison et al. used NIH Swiss Webster mice to establish a paralytic myelitis model induced by EV-D68, and the researchers compared five 2014 epidemic strains (cladeA strain KY / 14-18953 ; clade B strains IL / 14-18952 and CA / 14-4231; clade B1strains MO / 14-18947 and CA / 14-4232) and the neurovirulence of two prototype strains (Fermon and Rhyne), of which clade B1strains is 2014 The most widespread strain in the 2010 U.S. outbreak, none of which turned out to be a suitable challenge strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • EV-D68 (enterovirus-D68) and application of EV-D68 to preparation of EV-D68 infected animal
  • EV-D68 (enterovirus-D68) and application of EV-D68 to preparation of EV-D68 infected animal
  • EV-D68 (enterovirus-D68) and application of EV-D68 to preparation of EV-D68 infected animal

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Construction and Confirmation of Example 1 Enterovirus 68 Type EV-D68

[0037] The complete gene sequence of enterovirus type 68 Beijing strain with genbank accession number KP240936.1 was selected and synthesized to obtain the complete gene sequence. And introduce NotI (GCGGCCGC) and XhoI (CTCGAG) restriction sites in the 5'UTR and 3'UTR of the whole gene sequence of KP240936.1, respectively, and add the T7 promoter gene sequence TAATACGACTCACTATAGGG (T7promoter) in the 5'UTR, at the 3' UTR joins AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (Poly A tail); TAGCATAACCCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG (T7 terminator).

[0038] The full-length pBluescript II SK-EV-D68 plasmid used to prepare EV-D68 live virus was constructed with the prokaryotic expression vector pBluescript II SK provided by Zhongtaimeihe Company, which contains the entire gene sequence based on KP240936.1.

[0039]Co-transfect 293T cells with the plasmid pBluescript II SK-EV-D68 conta...

Embodiment 2

[0042] The TCID of embodiment 2EV-D68 virus 50 determination

[0043] In order to compare the changes in the virus titers of each generation after passage, the P5 to P10 generation viruses obtained by culturing in Example 1 were added to the 3- 12 columns, 100 μl per well, 100 μl of 2% fetal bovine serum DMEM medium was added to 1-2 columns, and 100 μl of 1×10 4 Cells / well of RD cells were cultured at 33°C for 7 days, and the TCID of different virus passages were calculated using the Reed-Muench method 50 .

[0044] Table 1 Different generations of virus TCID 50 Determination (experiment repeated three times)

[0045]

[0046] The results show:

[0047] The titers of the P5-P10 generation virus were 10 7.8 TCID 50 / ml;10 8 TCID 50 / ml;10 7.9 TCID 50 / ml;10 8 TCID 50 / ml;10 8 TCID 50 / ml;10 7.5 TCID 50 / ml, there was no significant difference between P5-P10 generation virus titers.

Embodiment 3P5

[0048] Embodiment 3P5 generations of virus attack different strains of 1-day-old suckling mice

[0049] Studies have shown that different viruses have different sensitivities for different strains of suckling mice. Therefore, the present invention selects different strains of 1-day-old suckling mice, and the strains include KM, NIH, C57, ICR and Balb / C. 30 μl and intraperitoneally inject 100 μl P5 generation virus (the original titer of the virus is 10 7.8 TCID 50 / ml), observe the clinical symptoms every day, and finally record the sensitivity of the virus to different strains of suckling mice.

[0050] Table 2 P5 generation virus attacks different strains of 1-day-old suckling mice in different ways (experiment repeated three times)

[0051]

[0052]

[0053] Note: animal sensitivity level; -: no clinical symptoms; ±: extremely weak clinical symptoms; +: weak clinical symptoms; ++: strong clinical symptoms;

[0054] The results showed that: KM suckling mice and NIH ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Titeraaaaaaaaaa
Login to View More

Abstract

The invention provides EV-D68 (enterovirus-D68), a construction method thereof and an application of the EV-D68 to preparation of an EV-D68 infected animal. The EV-D68 is a virus strain and is prepared through steps as follows: by starting from KP240936.1 complete genome sequence, the complete genome sequence is transfected to 293T cells, and the virus strain is obtained by infecting RD cells. TheEV-D68 P9 can be effectively applied to one-day-old Balb / C suckling mice, an EV-D68 challenge model is established, the suckling mice have the symptom of paralysis of fore limbs and hind limbs, further, all suckling mice are dead after challenge, and the requirement of the animal model is met.

Description

【Technical field】 [0001] The present invention relates to virology. In particular, the present invention relates to an enterovirus type 68 and the application of the virus in the preparation of a novel enterovirus EV-D68 virus infection animal model. 【Background technique】 [0002] In 1962, the United States first isolated a new type of enterovirus EV-D68 from patients with lower respiratory tract infection. The clinical symptoms caused by EV-D68 infection are mostly respiratory diseases (upper respiratory tract infection and lower respiratory tract infection), and severe cases can cause symptoms similar to central nervous system and poliovirus infection. Currently, EV-D68 has become a worldwide infectious disease. [0003] EV-D68 belongs to the Enterovirus genus of the family Picornaviridae. The genome of EV-D68 is about 7.4kb single-stranded positive-strand RNA, including an ORF and non-coding region sequences at both ends. ORF encodes a polyprotein, which is further c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/00C12N15/85A01K67/027A61K39/125A61P31/14C12R1/93
CPCA01K67/027A01K2227/105A01K2267/0337A61K39/12A61K2039/525A61P31/14C12N7/00C12N15/85C12N2770/32321C12N2770/32334C12N2770/32352C12N2800/107
Inventor 孙世洋梁争论毛群颖吴星高帆卞莲莲付莹胡亚林
Owner NAT INST FOR FOOD & DRUG CONTROL