EV-D68 (enterovirus-D68) and application of EV-D68 to preparation of EV-D68 infected animal
A technology of EV-D68 and enterovirus, applied in the preparation of new enterovirus EV-D68 virus infection animal model, in the field of enterovirus 68, can solve the problem of no challenge virus strains appearing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Construction and Confirmation of Example 1 Enterovirus 68 Type EV-D68
[0037] The complete gene sequence of enterovirus type 68 Beijing strain with genbank accession number KP240936.1 was selected and synthesized to obtain the complete gene sequence. And introduce NotI (GCGGCCGC) and XhoI (CTCGAG) restriction sites in the 5'UTR and 3'UTR of the whole gene sequence of KP240936.1, respectively, and add the T7 promoter gene sequence TAATACGACTCACTATAGGG (T7promoter) in the 5'UTR, at the 3' UTR joins AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (Poly A tail); TAGCATAACCCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG (T7 terminator).
[0038] The full-length pBluescript II SK-EV-D68 plasmid used to prepare EV-D68 live virus was constructed with the prokaryotic expression vector pBluescript II SK provided by Zhongtaimeihe Company, which contains the entire gene sequence based on KP240936.1.
[0039]Co-transfect 293T cells with the plasmid pBluescript II SK-EV-D68 conta...
Embodiment 2
[0042] The TCID of embodiment 2EV-D68 virus 50 determination
[0043] In order to compare the changes in the virus titers of each generation after passage, the P5 to P10 generation viruses obtained by culturing in Example 1 were added to the 3- 12 columns, 100 μl per well, 100 μl of 2% fetal bovine serum DMEM medium was added to 1-2 columns, and 100 μl of 1×10 4 Cells / well of RD cells were cultured at 33°C for 7 days, and the TCID of different virus passages were calculated using the Reed-Muench method 50 .
[0044] Table 1 Different generations of virus TCID 50 Determination (experiment repeated three times)
[0045]
[0046] The results show:
[0047] The titers of the P5-P10 generation virus were 10 7.8 TCID 50 / ml;10 8 TCID 50 / ml;10 7.9 TCID 50 / ml;10 8 TCID 50 / ml;10 8 TCID 50 / ml;10 7.5 TCID 50 / ml, there was no significant difference between P5-P10 generation virus titers.
Embodiment 3P5
[0048] Embodiment 3P5 generations of virus attack different strains of 1-day-old suckling mice
[0049] Studies have shown that different viruses have different sensitivities for different strains of suckling mice. Therefore, the present invention selects different strains of 1-day-old suckling mice, and the strains include KM, NIH, C57, ICR and Balb / C. 30 μl and intraperitoneally inject 100 μl P5 generation virus (the original titer of the virus is 10 7.8 TCID 50 / ml), observe the clinical symptoms every day, and finally record the sensitivity of the virus to different strains of suckling mice.
[0050] Table 2 P5 generation virus attacks different strains of 1-day-old suckling mice in different ways (experiment repeated three times)
[0051]
[0052]
[0053] Note: animal sensitivity level; -: no clinical symptoms; ±: extremely weak clinical symptoms; +: weak clinical symptoms; ++: strong clinical symptoms;
[0054] The results showed that: KM suckling mice and NIH ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
| Titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


