Unlock instant, AI-driven research and patent intelligence for your innovation.
A549 cell model for knocking out Toll-like receptor 3 (hTLR3)
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A receptor and cell technology, applied in the fields of biotechnology and medical diagnosis, can solve the problems of insufficient refinement of the TLR3 signaling mechanism, low drug safety, and unclear disease pathological characteristics.
Active Publication Date: 2018-08-31
SUZHOU GENEPHARMA +1
View PDF1 Cites 1 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
At this stage, drugs targeting TLR3 are still in the discussion stage, and there are still some problems in clinical application, such as unclear pathological characteristics of the disease, low drug safety, and insufficient refinement of the TLR3 signaling mechanism, etc.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0056] Embodiment 1, the design of gRNA and the construction of knockout plasmid
[0057] 1. Design of gRNA
[0058] For the Toll-like receptor 3 (hTLR3) gene (Gene ID: 7098), a large number of gRNA target sites were preliminarily selected, and then gRNA targeting each gRNA target site was prepared, the effect was verified, and gRNA with better effect was screened. Further, combine better gRNAs to prepare RNA molecules with double gRNAs (double gRNAs have double target sites).
[0059] In the Toll-like receptor 3 (hTLR3) gene, there is 1 transcript and 4 coding exons. In the first coding exon (the sequence of the sequence table is from 1-441 at the 5' end), three pairs of double gRNAs are designed, and the specific information is as follows:
[0060] The first pair of double gRNAs consisted of h-LR3-dgRNA1-L and h-TLR3-dgRNA1-R; the target sequence of h-LR3-dgRNA1-L was ATGGCTAACAGTGCACTTGG, and the target sequence of h-TLR3-dgRNA1-R was GTTGAGATAGCTCATTGTGC.
[0061] The s...
Embodiment 2
[0118] Embodiment 2, cell transfection and detection
[0120] 1. Inoculate A549 cells (CellBank of Chinese Academy of Sciences, SCSP-503) in 6-well plates (1.5×10 6 cells / well), using DMEM medium containing 10% FBS at 37°C in 5% CO 2 Cultivate for 24h.
[0121] 2. After completing step 1, take the 6-well plate, suck off the medium, add the transfection complex into the well, mix well, and store at 37°C in 5% CO 2 Cultivate for 5h.
[0122] Transfection complex: A: 250 μl serum-free DMEM medium + 2.5 μg knockout plasmid A1769; B: 250 μl serum-free DMEM medium + 5 μl GP-transfect-Mate (GenePharma), mix well, and place at room temperature for 5 minutes; mix A and After mixing, place at room temperature for 20 minutes.
[0123] 3. After completing step 3, take the 6-well plate, suck off the transfection complex, and add 1.5 ml of complete culture medium containing 10% FBS. Continue to culture at 37° C. 5% CO2 until 48 hours after transfection, ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses an A549 cell model for knocking out a Toll-like receptor 3 (hTLR3). A protective sgRNA combination is composed of the following two sgRNAs, namely sgRNA-1 and sgRNA-2. A targetsequence of the sgRNA-1 is shown as positions 435-454 from 5' end in a sequence 7 of a sequence table; a target sequence of the sgRNA-2 is shown as positions 794-813 from 5' end in the sequence 7 ofthe sequence table. The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / cas9 technology researches and clarifies that the A549 cell model for Knockout TLR3 is used for perfecting the intracellularsignal transduction pathway and mechanism, thus diseased cell or animal models can be constructed, and diseaseperception is facilitated, so that novel drug targets are searched for better clinical prevention and treatment services.
Description
technical field [0001] The invention relates to the fields of biotechnology and medical diagnosis, in particular to an A549 cell model knocking out Toll-like receptor 3 (hTLR3). Background technique [0002] The most basic function of the immune system is to recognize foreign antigens and induce the body to produce a series of responses to remove foreign pathogenic substances to maintain the stability of the body. The body's initial immune response to viruses and bacteria is generally considered to be non-specific, but the discovery of Toll-like receptors (Toll-like receptor, TLR) shows that the body can specifically recognize the immune response of viruses and bacteria. The main target molecules recognized by innate immune cells are called pathogen-associated molecular patterns (PAMPs). Sugar, flagellin, double-stranded RNA, and mannose on the cell wall of yeast, etc. Receptors that recognize PAMPs are called pattern recognition receptors (PRRs). TLRs molecules are an im...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More