Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A PCR-based rapid genetic sex identification method for Scylla Paramamosain

A technology of simulating mud crab and an identification method, which is applied in the field of sex identification of marine crabs, can solve the problems of difficulty in accurately distinguishing male and female, complicated operation, long time consumption, etc., and achieves the effects of low cost, good repeatability and simple operation.

Active Publication Date: 2018-09-25
SHANTOU UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for juvenile crabs, especially early-stage larvae, it is difficult to accurately distinguish males and females only from external morphological characteristics.
At present, the sex identification of the early developmental stage of Scylla syringus mainly adopts the method of sex-related SNP markers. Since this method needs to combine PCR amplification and sequencing technology to identify the sex of Scylla syringae, it has the disadvantages of complicated operation, high cost and time-consuming. , which greatly limits its application in practice, especially in large-scale population sex determination

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A PCR-based rapid genetic sex identification method for Scylla Paramamosain
  • A PCR-based rapid genetic sex identification method for Scylla Paramamosain
  • A PCR-based rapid genetic sex identification method for Scylla Paramamosain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. Primer Design

[0032] According to the known DNA sequence and female-specific SNP sites, a pair of control primers and three pairs of female-specific primers were designed using the primer design software Primer Premier 5.0. The nucleotide sequences of the control primers are:

[0033] Control-F: 5'GTTCTGCTTATCATAGTTATTGCCTTG 3';

[0034] Control-R: 5' CTGCCAGTGATTCAGTGACTTAGC 3';

[0035] The nucleotide sequence of the upstream primer in the three pairs of female-specific primers is:

[0036] Female-specific-F1: 5' C TTAGTATATCACAAC T ACATCAG G ATG T 3';

[0037] Female-specific-F2: 5'TTAGTATATCACAAC T ACATCAG GC TG T 3';

[0038] Female-specific-F3: 5'TTAGTATATCACAAC T ACATCGG G A G G T 3'

[0039] Bold and underlined letters are mismatched bases and corresponding sites.

[0040] Three pairs of female-specific primers share a downstream primer whose nucleotide sequence is

[0041]Female-specific-R1: 5'AAGATGCTTGCTGTCTCATTGGT 3'.

[0042] 2. S...

Embodiment 2

[0058] A method for rapid identification of the genetic sex of Scylla pseudocaveus based on PCR technology, such as figure 1 It mainly includes the following steps:

[0059] 1. Primer Design

[0060] According to the known DNA sequence and female-specific SNP sites, the primer design software Primer Premier 5.0 was used to design control primers and female-specific primers. The nucleotide sequence of the control primers was:

[0061] Control-F: 5'GTTCTGCTTATCATAGTTATTGCCTTG 3';

[0062] Control-R: 5' CTGCCAGTGATTCAGTGACTTAGC 3';

[0063] The nucleotide sequence of the female-specific primer is:

[0064] Female-specific-F: 5'CTTAGTATATCACAACTACATCAGGATGT 3';

[0065] Female-specific-R: 5'AAGATGCTTGCTGTCTCATTGGT 3'.

[0066] 2. Sampling and Genomic DNA Extraction

[0067] (1) Collect 24 adult crabs from Niutianyang Breeding Base in Shantou City, including 12 female crabs and 12 male crabs. The sexes were determined according to the morphological characteristics of the abdo...

Embodiment 3

[0077] Using the genomic DNA of 60 juvenile mud crabs (larvae 1st stage) of unknown gender as templates, steps 3-5 in the examples were repeated. The result is as image 3 shown, where M is DNA Marker, the band at 320bp is a female-specific band; 1, 3, 6, 14-16, 22, 24, 28, 30, 31, 33-36, 38, 40, 44, 48-51, 54 and 60 were identified as female crabs, and the rest were identified as male crabs.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A PCR-based rapid genetic sex identification method for Scylla Paramamosain is disclosed. The method includes (1) designing control primers, and designing female-specific primers by utilizing a base mismatch process; (2) extracting genome DNA of a Scylla Paramamosain individual to be tested; (3) by using the control primers and female-specific primers respectively, and by using the genome DNA of Scylla Paramamosain as a template, performing PCR amplification at an annealing temperature of 65 DEG C to obtain corresponding PCR products; and (4) detecting the PCR products through electrophoresiswith agarose gel having a concentration of 1.5% to determine whether the individual is male or female. According to the method, the base mismatch process of the sex-specific SNP site is utilized to design the female-specific primers, amplification is performed through an optimized PCR reaction system and a PCR reaction program, and then electrophoresis with agarose gel is performed for detection to achieve genetic sex identification of the Scylla Paramamosain. The method has advantages of simple operation, a high accuracy rate, a low cost, good repeatability and high practicability, and can beused for large-scale rapid identification for Scylla Paramamosain in the early period of growth and development.

Description

technical field [0001] The invention belongs to the marine crab sex identification technology in the technical field of aquatic organisms, and in particular relates to a rapid identification method for the genetic sex of mud crabs based on PCR technology. Background technique [0002] The genus Scylla belongs to Crustacea, Decapoda, and Portunidae, and is mainly distributed in the Western Pacific, Southeast Asia, Australia, Indian Ocean, South Africa and other sea areas. Among them, the blue crab is mainly distributed in the coasts of the East my country Sea and the South China Sea. Because of its large size, fast growth, delicious meat and rich nutrition, it is regarded as a precious seafood food in modern and modern times, and it is also a traditional mariculture species in my country. and marine fishing resources. [0003] In recent years, the production of artificial breeding of blue crabs in my country has continued to increase, and has maintained a good momentum of dev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6879C12Q1/6888
CPCC12Q1/6879C12Q1/6888C12Q2600/156Y02A40/81
Inventor 马洪雨石西苗贵东章跃陵刘文华郑怀平李升康
Owner SHANTOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products