Homocysteine ​​methyltransferase mutant and application thereof, as well as nucleic acid, expression vector, host cell, reagent

A cystine methyl, host cell technology, applied in homocysteine ​​methyltransferase mutants and their applications, as well as in the fields of nucleic acids, expression vectors, host cells, and reagents, can solve the problem of low activity and low relative activity and other problems, to achieve the effect of high expression, stable recombinant plasmid and improved stability

Active Publication Date: 2021-09-03
浙江微景生物科技有限公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the homocysteine ​​methyltransferase in the above scheme only improves the heat resistance, but the enzyme often needs to be stored at 4°C for several months or even years, and the high temperature stability at 40°C must be good, while the 40°C in the above scheme ℃, after 15 minutes, only 60% of the relative activity is still relatively low, and the overall activity is still relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Homocysteine ​​methyltransferase mutant and application thereof, as well as nucleic acid, expression vector, host cell, reagent
  • Homocysteine ​​methyltransferase mutant and application thereof, as well as nucleic acid, expression vector, host cell, reagent
  • Homocysteine ​​methyltransferase mutant and application thereof, as well as nucleic acid, expression vector, host cell, reagent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Error-prone PCR (error-prone PCR) method to construct HMT mutation library

[0052] use Gene The Morph II random mutagenesis kit uses the optimized nucleotide sequence of HMT (see SEQ ID NO.2) as a template to amplify the HMT gene and introduce mutations randomly.

[0053] Amplification primer

[0054] F: 5'-CATG CCATGG CTAGATTGCCATTGAAG (NcoI endonuclease is underlined)

[0055] R: 5'-CCG CTCGAG AGTGTACTTCTTAACAGCAG (XhoI endonuclease underlined)

[0056] Reaction conditions: The reaction conditions are: pre-denaturation at 94°C for 10 minutes, denaturation at 94°C for 30 seconds, annealing at 60°C for 60 seconds and extension at 72°C for 2 minutes, a total of 25 cycles, 0.8% agarose electrophoresis, and the kit to recover the target gene fragment . According to the method described in the product manual of NEB Company, after double digestion with NcoI and XhoI, ligate with the pET-28a(+) vector (kana resistance) that has been digested with NcoI and X...

Embodiment 2

[0057] Example 2 Screening of HMT mutant library

[0058] After the mutant library clones in Example 1 were collected, the plasmids were extracted, transformed into Escherichia coli expression strain BL21 (DE3), spread on LB plates containing kana, and cultured for 12 hours. Pick a single clone in a 96-well plate, each well contains 150 μL of TB medium (containing 50 μg / mL kanamycin, 1 mM IPTG), 37 ° C, 245 rpm, shaking culture for 36 h. The 96-well plate replicator replicated each single clone on an LB solid medium plate, cultured at 37°C for 12 hours, and stored in a refrigerator at 4°C. Gently suck out the cell cultures in each well of the 96-well plate with a row gun, and distribute them in the 96-well plates of plate A and plate B according to the corresponding positions, and the culture in each well of each 96-well plate is 70 μL. Centrifuge at 4000rpm at 4°C for 10min, discard the supernatant, and resuspend the bacterial cells in each well with 30μL, 50mM, pH7.6 sodium...

Embodiment 3

[0059] Embodiment 3 Stability detection

[0060] The mutants in plate B corresponding to the increased activity in plate A were tested for stability.

[0061] Screen out 4 mutants that affect the activity, and send the mutant monoclonal to the sequencing company for sequencing. The amino acid sequence is shown in SEQ ID NO.3-SEQ ID NO.6

[0062] The four mutation positions are D53, D283, L252, and Q219, respectively.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention screens out a homocysteine ​​methyltransferase mutant by error-prone PCR and site-directed mutation, which contains one or two amino acids at D53, D283, L252, and Q219 on the basis of wild-type HMT. The above amino acid mutations. The mutant doubled its activity and improved its stability. The present invention also discloses the nucleic acid encoding the homocysteine ​​methyltransferase mutant, the expression vector comprising the nucleic acid, the host cell comprising the expression vector, and the homocysteine-S-A A reagent of at least one of a base transferase mutant, a nucleic acid, an expression vector, and a host cell.

Description

technical field [0001] The present invention relates to an enzyme and its application, a nucleic acid encoding the enzyme, an expression vector comprising the nucleic acid, a host cell comprising the expression vector, and at least one of the above-mentioned enzyme, nucleic acid, expression vector, and host cell reagents. More specifically, it relates to homocysteine ​​methyltransferase mutants and applications thereof, nucleic acids encoding the homocysteine ​​methyltransferase mutants, expression vectors including said nucleic acids, including said expression A host cell of the vector, and a reagent including at least one of the above-mentioned homocysteine ​​methyltransferase mutant, nucleic acid, expression vector, and host cell. Background technique [0002] Methyltransferase can catalyze the transfer of the methyl group on S-adenosylmethionine (SAM) to the substrate molecule, generate a variety of important physiologically active substances containing methyl groups, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12Q1/48
CPCC12N9/1007C12N15/70C12Q1/48C12Y201/0101G01N2333/91017
Inventor 彭毅王晓霞
Owner 浙江微景生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap