Recombinant virus vector and vaccine and preparation method and application thereof

A technology of recombinant viral vectors and viral vectors, applied in the field of immunity, to achieve the effects of easy cultivation, easy mass production, and easy use

Active Publication Date: 2018-10-30
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently no vaccine against SFTS virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant virus vector and vaccine and preparation method and application thereof
  • Recombinant virus vector and vaccine and preparation method and application thereof
  • Recombinant virus vector and vaccine and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, the preparation of candidate vaccine

[0037] 1. Preparation of the recombinant rVSV viral vector plasmid rVSV-SFTSV / AH12-GP of the SFTSV AH12 strain of the Chinese clade

[0038] In order to develop the SFTSV vaccine, we humanized and optimized the sequence encoding the glycoprotein Gn / Gc of the SFTSV AH12 strain of the Chinese clade (Genbank accession number ADZ04482.1) and inserted it into the rVSVΔG vector, named rVSV-SFTSV / AH12 -GP. The specific operation is: optimize the protein sequence of the glycoprotein Gn / Gc according to the human codon code, so as to increase the expression of the protein in the human body.

[0039] Wherein, the DNA sequence of the humanized Gn / Gc protein of the SFTSV AH12 strain inserted into the rVSVΔG vector: as shown in SEQ ID NO: 1:

[0040]atgatgaaagtgatctggttcagcagcctgatctgcctcgtgatccagtgcagcggcgacagcggccctatcatctgtgccggacccatccacagcaacaagagcgccgacatcccccatctgctgggctacagcgagaagatttgccagatcgaccggctgatccacgtgtcctcttggctg...

Embodiment 2

[0061] Embodiment 2, the detection of recombinant rVSV virus

[0062] The virus particles in the supernatant of 293T cells after transfection were collected, and the recovered rVSV-SFTSV / AH12-GP, rVSV-eGFP-SFTSV / AH12-GP and rVSV-eGFP-SFTSV / YG1-GP viruses were concentrated and purified by an ultracentrifuge , condensed into pellets, and recognized using polyclonal antibodies to Gn and Gc of SFTSV that recognize the embedded glycoproteins Gn and Gc. The result is as figure 1 As shown in A, the control group was set as the supernatant of untransfected 293T cells.

[0063] The results showed that Gn and Gc could be detected in rVSV-SFTSV / AH12-GP, rVSV-eGFP-SFTSV / AH12-GP and rVSV-eGFP-SFTSV / YG1-GP by polyclonal antibodies to SFTSV Gn and Gc.

[0064] Virus particles in the supernatant of transfected 293T cells were collected and infected Vero cells. When Vero cells were infected with rVSV virus, the multiplicity of infection was 0.01, and the virus titer in the supernatant of Ve...

Embodiment 3

[0069] Example 3. Immunization with rVSV-SFTSV / AH12-GP can induce a strong specific neutralization response

[0070] To evaluate the immunogenicity of rVSV-SFTSV / AH12-GP in an immunocompetent C57 / BL6 mouse model. Intraperitoneal injection of a single dose of 2 × 10 4 After equal-dose inoculation with PFU rVSV-SFTSV / AH12-GP as the experimental group or WT rVSV-G as the control group, the mice did not lose body weight compared with mock-infected animals. 30 days after immunization, rVSV-eGFPs (rVSV-eGFP-SFTSV / AH12-GP, rVSV-eGFP-SFTSV / YG1-GP, rVSV-eGFP-HRTV-GP and control rVSV-eGFP-EboV-GP) were used as controls Neutralizing antibodies were quantitatively determined by neutralizing the sera after immunization with mice. see results figure 2 .

[0071] figure 2 The results showed that rVSV-SFTSV / AH12-GP induced a strong specific humoral immune response in C57 / BL6 mice. After vaccination with rVSV-SFTSV / AH12-GP vaccine, strong broad-spectrum neutralizing antibodies against ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of immune and discloses a recombinant virus vector and a vaccine against virus SFTS (severe fever with thrombocytopenia syndrome) and a preparation methodand application thereof. The recombinant virus vector is DNA molecules virus vector with glycoproteins Gn / Gc which can encode severe fever with thrombocytopenia syndrome virus. Furthermore, the recombinant virus and the virus transcription composite and the like transform host cells and collect viral particles with infective capacity which is a live virus vector vaccine. Compared with the prior technology, the vaccine has the advantages of easy cultivation, effective infection, easy utilization, capacity of stimulating host to produce strong immune reaction to cells, strong immune reaction tofluid and relatively strong immune reaction to mucosa, good safety, and the like.

Description

technical field [0001] The invention belongs to the technical field of immunization, and in particular relates to a recombinant virus vector and a vaccine, in particular to a recombinant virus vector, a vaccine for fever with thrombocytopenia syndrome, a preparation method and application thereof. Background technique [0002] Fever with thrombocytopenia syndrome (SFTS), an emerging hemorrhagic fever, has its first cases in rural China. The causative agent of SFTS is SFTS virus (SFTSV), a novel phlebovirus of the family Bunyaviridae, which is transmitted through tick bites. SFTS virus particles are spherical, about 80-100nm in diameter, with a lipid envelope and 5-10nm long polypeptide spines on the surface. The SFTS viral genome consists of three small, medium and large negative-strand RNA segments. The middle RNA fragment has 3378 nucleotides, which contains a single open reading frame of 1073 amino acids encoding glycoprotein Gn / Gc, which is very important for virus ass...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/861C12N15/863C12N15/869C12N15/66A61K39/12A61P31/14
CPCA61K39/12A61K2039/5256A61P31/14C12N15/66C12N15/86C12N2710/10043C12N2710/24043C12N2760/12234C12N2760/20043
Inventor 郑爱华袁菲邹振董方方
Owner INST OF ZOOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap