X-SCID lentivirus carrier, lentivirus as well as preparation method and application thereof

A lentiviral vector and lentiviral technology, applied in the field of genetic engineering, can solve the problems of low immune stimulation and poor safety performance, and achieve the effect of high transfection efficiency, strong stability and good safety

Inactive Publication Date: 2018-11-02
SHENZHEN GENO IMMUNE MEDICAL INST
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This is due to the fact that the insertion site of the MLV virus is relatively random and has poor safety performance. However, lentiviral vectors such as HIV-1 have not found such random insertion carcinogenic problems in many years of clinical application. There is a wider application space in the field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • X-SCID lentivirus carrier, lentivirus as well as preparation method and application thereof
  • X-SCID lentivirus carrier, lentivirus as well as preparation method and application thereof
  • X-SCID lentivirus carrier, lentivirus as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] The construction of embodiment 1 lentiviral vector

[0063] This embodiment provides a method for constructing a lentiviral vector, which specifically includes the following steps:

[0064] (1) Schematic diagram of the transformation of the lentiviral vector pTYF as shown in figure 1 As shown, the specific mutation is to mutate the wild-type 5' splice donor site GT to CA, and delete the enhancer in U3. The specific transformation method can be found in "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI, JOURNAL OF VIROLOGY, July 1999, p.6171–6176”, as follows:

[0065] Transformation of 5' splicing donor site: wild type (SEQ ID NO.3): GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA; mutant type (SEQ ID NO.4): GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0066] (2) Insertion of promoter and IL-2RγC gene:

[0067] Synthesize the normal IL-2RγC gene sequence (as shown in SEQ ID NO.1) an...

Embodiment 2

[0072] Preparation and identification of embodiment 2 lentivirus

[0073] 1) Preparation of lentivirus

[0074] The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain the lentivirus. The specific process is as follows: image 3 As shown, the specific steps are as follows:

[0075] (1) Co-transfect the constructed lentiviral vector with the packaging helper plasmids pNHP and pHEF-VSV-G into mammalian cells HEK293T and culture for 24-72h;

[0076] (2) Purifying and concentrating the cultured lentivirus to obtain the lentivirus.

[0077] 2) Identification of lentivirus

[0078] The collected lentivirus-transfected cells carrying normal IL-2RγC gene were identified for protein expression, so as to clarify the expression of IL-2RγC gene in the cells.

[0079] From the results, there is no expression of IL-2RγC protein in the negative control cells without lentivirus transfection, but a significantly larger amount of IL-2RγC protein...

Embodiment 3

[0081] The therapeutic effect of embodiment 3 lentivirus

[0082] The schematic diagram of the treatment process for treating X-SCID disease with the dual stem cell system obtained by transfecting the lentiviral vector of the present invention prepared in Example 2 carrying the normal IL-2RγC gene is as follows Figure 4 As shown, after the patient’s stem cells were mobilized, the peripheral blood of the patient was collected and the hematopoietic stem cells and mesenchymal stem cells were separated, and the double stem cells were transfected with the lentiviral vector carrying the normal IL-2RγC gene to obtain the stem cells carrying the normal IL-2RγC gene. It is injected back into the patient's body by intravenous injection for disease treatment.

[0083] It can be seen from the results that after direct injection of lentivirus, the delivery efficiency and expression level of IL-2RγC gene can be effectively improved.

[0084] In summary, the lentiviral vector of this appli...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an X-SCID lentivirus carrier, lentivirus as well as a preparation method and application thereof. According to the lentivirus carrier, transformation is conducted on a donor splicing site of the 5' end of a pTYF lentivirus carrier, wherein the lentivirus carrier further comprises an IL-2RgammaC gene. On the basis of the transformed lentivirus carrier, the IL-2RgammaC gene isspecifically connected, so that not only is the safety ensured, but also more efficient gene transmission is achieved, thus the expression quantity of the IL-2RgammaC gene in transgenic related cellsis obviously improved, and transferring of normal genes in an X-SCID gene therapy process is completed more efficiently.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to an X-SCID lentiviral vector, a lentivirus and a preparation method and application thereof, in particular to an application of an improved lentiviral vector to optimize the expression of IL-2RΓC gene for preparing and treating heterochromia Drugs for Leukodystrophy. Background technique [0002] Gene therapy (Gene Therapy) is a new type of disease treatment that has gradually emerged with the theoretical research on the pathogenic mechanism of various diseases and the development of gene technology. And some autoimmune diseases bring new direction and hope. The so-called gene therapy refers to interfering with the occurrence and development of diseases in the body by manipulating genetic materials through special delivery carriers, including replacing or correcting the disorder of the organism's own gene structure or function, killing diseased cells or enhancing the bo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/867C12N7/01C12N5/10A61K48/00A61K38/20A61P37/04
CPCA61K38/2013A61K48/0025A61K48/005A61P37/04C12N5/0634C12N5/0665C12N15/86C12N2510/00C12N2740/15043A61K35/76A61K38/00C07K14/7155C12N2740/16043
Inventor刘崇灵
OwnerSHENZHEN GENO IMMUNE MEDICAL INST