Recombinant E.coli (Escherichia coli) and application thereof
A technology for recombining Escherichia coli and Escherichia coli, which is applied in applications, recombinant DNA technology, bacteria, etc., can solve the problems of VC loss of reducing activity, limited application, VC instability, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Construction of recombinant Escherichia coli E.coli IEF-blsp101 containing L-ascorbic acid glycosylase gene
[0027] Genomic DNA of bifidobacterium longum (Bifidobacterium longum) IEF101 in the mid-logarithmic growth phase was extracted using a bacterial genomic DNA extraction kit, and used as a template to perform PCR amplification with the following primers:
[0028] bloSP-F:
[0029] GCCTGGTGCCGCGCGGCAGCCATATGAAAAACAAAGTGCAACTCATC;
[0030] bloSP-R:
[0031] GTCGACGGAGCTCGAATTCGGATCCTTAGTCGATATCGGCAATCGG.
[0032] The high-efficiency fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase from Vazyme Biotech Co., Ltd. was used for PCR amplification. The PCR amplification program was: 95°C for 3min; 95°C for 15s, 58°C 15s at ℃, 1.5min at 72℃, 30 cycles; 5min at 72℃.
[0033] The obtained PCR product was purified using a PCR product recovery kit, and cloned between Nde I and BamHI of the pET28a+ plasmid using the One Step Cloning Kit of Nanjing Novizan Bio...
Embodiment 2
[0035] Embodiment 2, preparation produces the fermented broth bacterial agent of AA-2G
[0036] The E.coliIFE-blsp101 prepared in Example 1 was cultured in a seed medium containing 50 μg / mL kanamycin at 37° C. and 200 rpm to the mid-logarithmic growth phase to obtain a seed solution.
[0037] Inoculate the freshly cultivated seed liquid into the fermentation medium containing 50mg / L kanamycin at an inoculum volume concentration of 5%, culture at 35°C for 5h, add a final concentration of 10g / L α-lactose, and control the fermentation temperature at 23°C , the dissolved oxygen DO is controlled to be greater than 20%, the fermentation pH is controlled to 6.8 with 25% ammonia water, and the fermentation is continued for 12 hours to obtain a fermented liquid with a wet cell content of 30g / L as a catalyst.
[0038] Dilute the fresh fermentation broth 3 times with deionized water, so that the content of wet bacteria is 10g / L. After crushing the cells with a high-pressure cell homogeni...
Embodiment 3
[0039] Application of embodiment 3 bacterial agents in the production of AA-2G
[0040] 1. Detection of catalytic activity of fermentation broth
[0041] Centrifuge the fermented broth prepared by the method in Example 2, take 0.5 g of wet bacterial cells and resuspend them in 50 mL of pH 5.2, 50 mM sodium citrate buffer, break the bacterial cells with a high-pressure homogenizer, and add a final concentration of 210 g / 1L of VC and 270g / L of sucrose constitute a 50ml reaction system. The catalytic reaction was stirred in a water bath at 40°C for 12h. The reaction solution was used for HPLC analysis. The residual substrate VC concentration was measured to be 164g / L, and the formed product AA- The concentration of 2G is 30g / L.
[0042] Liquid chromatography detection conditions: sample pretreatment, take 50 μL of reaction solution, add it to 950 μL of 0.01mol / L dilute hydrochloric acid, filter it with a 0.22 μm filter membrane, add the filtrate to the liquid phase sample bottl...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

