Method for realizing genome editing and accurate and targeted knock-in of genes in fishes

A genome editing and gene knock-in technology, applied in the biological field, can solve the problems of multi-copy insertion, large workload, and low efficiency of fixed-point integration, and achieve the effect of reducing cost and improving efficiency.

Active Publication Date: 2018-12-07
FUZHOU UNIV
View PDF19 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are also reports that some laboratories use the principle of NHEJ instead of homologous recombination (HR) to carry out knock-in (Thomas O. Auer, et al. 2014). This method simultaneously generates DSBs on the zebrafish genome and donor DNA, thereby mediating The direct connection between the genome and the exogenous DNA at the broken chain can realize the insertion and integration of specific exogenous DNA, but because NHEJ itself is easy to generate indels, and the indels are highly random, so the efficiency of site-specific integration is not high. High, only 4%; in addition, this method is prone to the problem of multi-copy insertion; finally, this method is more beneficial for the integration of certain types of special foreign DNA fragments, such as Gal4, GFP, etc., otherwise the workload of later screening will be larger

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for realizing genome editing and accurate and targeted knock-in of genes in fishes
  • Method for realizing genome editing and accurate and targeted knock-in of genes in fishes
  • Method for realizing genome editing and accurate and targeted knock-in of genes in fishes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Preparation of wild-type Cas9 or Cas9n-D10A sequence and sgRNA

[0048] The wild-type Cas9 or Cas9n-D10A sequence was added to the nuclear localization sequence (the sequence is CCGCCACC), and then the SP6 promoter sequence (the sequence was CATACGATTTAGGTGACACTATAG) was added upstream of the entire sequence, and the capping was obtained using an in vitro transcription kit (capped) and polyA-added mRNA, the obtained Cas9 or Cas9n-D10A mRNA was mixed in different combinations and frozen at -80°C for later use. The sgRNA has a T7 promoter sequence upstream and a downstream sequence partially complementary to the upstream through DNA synthesis, and double-stranded DNA is obtained by PCR amplification, which is obtained using an in vitro transcription kit.

[0049] DNA template sequence for sgRNA synthesis Primer synthesis sequence

[0050]

Embodiment 2

[0051]Example 2. Mapping potential nicks at the target site of integration of zebrafish Ndr2 and GFAP

[0052] Query and download the zebrafish Ndr2 genome sequence (NM_139133) on the genome database (such as NCBI: https: / / www.ncbi.nlm.nih.gov / ), and perform PAM analysis on the sequence of the region to be integrated, according to figure 1 The spacing shown selects the two PAM sites with higher scores.

[0053] 以斑马鱼Ndr2为例,分析结果如下:agcagcaggacggggccagtctcctgcacactgccggggcctcgaagtttctgttttctagaaataagaaagaagtcaagcgaggacgggccctcaggagccgcaggggccgccg(PAM1)ggggcc(插入区域)acctgtcaggagcccagagctgcagagaacaccactgcacaagagcaccacctgcagg(PAM2)agggtggacatgcatgtggattttaaccagatcggatggggctcctggatcgtgttccctaagaagtacaa

[0054] Taking zebrafish GFAP as an example, the analysis results are as follows:

[0055] caattaagttgtccccaaaaacatctcaagaattgtgttgattctgctaattcttcattttacacattctctctttcgcagatcattaaagagtcca(PAM1)ctacggagaggaaggatctgccataa(终止子)tgaggctcagacactggcttggctgcagaagaagatctccttcactaatgcttcagg (PAM...

Embodiment 3

[0056] Example 3. Preparation of exogenous donor DNA Ndr2-linker-Dendra2 and GFAP-p2AV1-NpHR3.0-EYFP-p2AV2-hChR2-mCherry-IRES-WGA-Cre (GFAP-5.5 kb)

[0057] Such as figure 2 As shown, when preparing an exogenous donor, first, we use primers to amplify and purify the 5' homology arm (5' HA), the insert fragment, the 3' homology arm (3' HA) and the vector backbone ; Then, the 5'HA, insert and 3'HA were bridging PCR in pairs to obtain three PCR fragments connected together; finally, the 5'HA-insert-3'HA product and the vector backbone fragment were passed through In-Fusion The HD cloning kit (Clonetech, 639649) was seamlessly connected and transformed into E. coli, and the exogenous donor DNA was obtained after identification by picking clone sequencing, and Ndr2-linker-Dendra2 and GFAP-p2AV1-NpHR3.0-EYFP- p2AV2-hChR2-mCherry-IRES-WGA-Cre (GFAP-5.5 kb).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for realizing genome editing and accurate and targeted knock-in of genes in fishes. A technology of producing DNA single-chain gap based on nicking enzyme is utilized,assisted with a set of homologous recombination repair factor RecOFAR, so as to realize high-efficient, accurate and targeted integration of genome editing and gene knock-in in the fishes. The problems that a current existing method is low in efficiency, and random mutation efficiency of target points is higher are overcome.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for realizing precise genome editing and fixed-point gene knock-in in fish. Background technique [0002] With the continuous development and improvement of whole genome sequencing technology and the implementation of large-scale genome annotation projects, biological science research has entered the post-genome era. In the post-genome era, the focus of genome research will shift to gene function, that is, from determining the DNA sequence of genes and explaining all the genetic information of life to the study of biological functions at the molecular level, exploring human health and human health at the molecular level. The mystery of disease (Peltonen and McKusick, 2001). Researchers have begun to make various attempts to apply the results of genome research to various fields of basic scientific research and personalized medicine (Chan and Ginsburg, 2011). Ho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/89A01K67/027
CPCA01K67/0278A01K2207/15A01K2217/072A01K2227/40C12N15/89
Inventor杨宇丰何小镇
OwnerFUZHOU UNIV