Recombinant fusion cytokine IL-7-Linker-IL-15 adenovirus, and construction method and application thereof
A technology of pdc316-il-7-linker and fused cells, which can be applied in applications, viruses, fusion polypeptides, etc., and can solve the problem of less adjuvant
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0093] Example 1: Construction and packaging of fusion cytokine IL-7-Linker-IL-15
[0094] (1) Construction of recombinant gene vector pDC316-IL-7-Linker
[0095] The gene pUC57-IL-7-Linker was synthesized by Beijing Huada University, and IL-7-Linker primers were designed for amplification according to the gene sequence. The primers are: upstream (5’-3’GA AGATCT ATGTTCCATGTTTCTTTTAGATATATCTTTGG, where italics are Bgl II restriction site); downstream (5’-3’ TAGGC AAGCTT ACTTGGTGGTGGCGATGGTGGTGGACTT, where italics are Hin d III restriction site).
[0096] Using the pUC57-IL-7-Linker plasmid as the vector, using the above two primers, the IL-7-Linker fusion gene product was amplified by PCR. After the PCR product is purified, use Bgl II and Hin d III was subjected to double restriction digestion, and the clone was constructed on the plasmid pDC316 to construct the pDC316-IL-7-Linker vector.
[0097] (2) Construction of recombinant gene vector pDC316-IL-7-Linker-IL-15
[0098] The...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



