Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant fusion cytokine IL-7-Linker-IL-15 adenovirus, and construction method and application thereof

A technology of pdc316-il-7-linker and fused cells, which can be applied in applications, viruses, fusion polypeptides, etc., and can solve the problem of less adjuvant

Inactive Publication Date: 2018-12-18
LANZHOU UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are currently few clinically approved adjuvants that primarily promote humoral immune responses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant fusion cytokine IL-7-Linker-IL-15 adenovirus, and construction method and application thereof
  • Recombinant fusion cytokine IL-7-Linker-IL-15 adenovirus, and construction method and application thereof
  • Recombinant fusion cytokine IL-7-Linker-IL-15 adenovirus, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] Example 1: Construction and packaging of fusion cytokine IL-7-Linker-IL-15

[0094] (1) Construction of recombinant gene vector pDC316-IL-7-Linker

[0095] The gene pUC57-IL-7-Linker was synthesized by Beijing Huada University, and IL-7-Linker primers were designed for amplification according to the gene sequence. The primers are: upstream (5’-3’GA AGATCT ATGTTCCATGTTTCTTTTAGATATATCTTTGG, where italics are Bgl II restriction site); downstream (5’-3’ TAGGC AAGCTT ACTTGGTGGTGGCGATGGTGGTGGACTT, where italics are Hin d III restriction site).

[0096] Using the pUC57-IL-7-Linker plasmid as the vector, using the above two primers, the IL-7-Linker fusion gene product was amplified by PCR. After the PCR product is purified, use Bgl II and Hin d III was subjected to double restriction digestion, and the clone was constructed on the plasmid pDC316 to construct the pDC316-IL-7-Linker vector.

[0097] (2) Construction of recombinant gene vector pDC316-IL-7-Linker-IL-15

[0098] The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method for a recombinant fusion cytokine IL-7-Linker-IL-15 adenovirus. The method comprises the following steps: constructing a pDC316-IL-7-Linker vector, and then linking an IL-15 fragment to the pDC316-IL-7-Linker by a gene cloning process in order to construct pDC316-IL-7-Linker-IL-15; and finally co-transferring the pDC316-IL-7-Linker-IL-15 and backbone vectors pBHGlox[delta]E1 and 3Cre into HEK293 cells, and carrying out packaging to obtain the adenovirus expressing the fusion cytokine IL-7-Linker-IL-15. The recombinant IL-7 Linker-IL-15 adenovirus is applied to a tuberculosis subunit vaccine as an adjuvant in order to regulate the differentiation of memory T cells after vaccine immunization, enhance the vaccine-induced central memory T cell-mediated immune response and enhance the immune protection effect of the tuberculosis subunit vaccine.

Description

Technical field [0001] The present invention specifically relates to the construction of a recombinant fusion cytokine IL-7-Linker-IL-15 adenovirus; the invention also relates to the fusion cytokine IL-7-Linker-IL-15 as a cellular immune adjuvant in tuberculosis The application strategy of unit vaccine belongs to the field of vaccine manufacturing technology. Background technique [0002] Tuberculosis (tuberculosis) is an infection mainly caused by Mycobacterium tuberculosis ( Mycobacteria tuberculosis ) Chronic infectious diseases caused by. Its case fatality rate ranks first among infectious diseases and is the ninth leading cause of death in the world. The best way to prevent and control infectious diseases is to inoculate effective vaccines. The main reason why tuberculosis is difficult to control is the lack of effective tuberculosis vaccines. The only clinically approved vaccine for preventing tuberculosis is the live attenuated Mycobacterium bovis vaccine BCG (Bacille C...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/861A61K39/39A61K39/04A61P31/06
CPCA61K39/04A61K39/39A61K2039/5256A61K2039/55527A61P31/06C07K14/5418C07K14/5443C07K2319/00C12N7/00C12N15/86C12N2710/10021C12N2710/10043
Inventor 祝秉东白春香何娟娟吕薇唐君霞周利军韩江媛牛红霞
Owner LANZHOU UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com