DC (Dendritic cell)-CIK (Cytokine-induced killer cell) immune cell modified by both AFP (Alpha-fetoprotein) and HBsAg (Hepatitis B surface antigen) antigen genes as well as preparation method and application of the cell

A technology of gene modification and immune cells, which is applied in the direction of genetically modified cells, cells modified by introducing foreign genetic material, blood/immune system cells, etc. question

Inactive Publication Date: 2018-12-21
武汉大学人民医院
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These two types of DCs have obvious shortcomings: empty-loaded DCs can only express basic co-stimulatory factors and adhesion factors and have no specificity; The effect is not good, the specificity is low, and the curative effect is not significant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DC (Dendritic cell)-CIK (Cytokine-induced killer cell) immune cell modified by both AFP (Alpha-fetoprotein) and HBsAg (Hepatitis B surface antigen) antigen genes as well as preparation method and application of the cell
  • DC (Dendritic cell)-CIK (Cytokine-induced killer cell) immune cell modified by both AFP (Alpha-fetoprotein) and HBsAg (Hepatitis B surface antigen) antigen genes as well as preparation method and application of the cell
  • DC (Dendritic cell)-CIK (Cytokine-induced killer cell) immune cell modified by both AFP (Alpha-fetoprotein) and HBsAg (Hepatitis B surface antigen) antigen genes as well as preparation method and application of the cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Construction of recombinant lentiviral expression system for AFP and HBsAg

[0049] 1. Construction of pHAGE-AFP-HBsAg recombinant plasmid:

[0050] According to the full-length CDS sequences of AFP and HBsAg registered in GeneBank, we designed the following 2 pairs of primers, which introduced BamH Ⅰ, Xho Ⅰ, Xho Ⅰ and Nhe Ⅰ restriction sites at P1, P2, P3 and P4 respectively:

[0051] P1: GGATTC ATGAAGTGGGTGGAATCAAT

[0052] P2: CTCGAG TTAAACTCCCAAAGCAGCA

[0053] P3: CTCGAG ATGGGAGGTTGGTCTTCC

[0054] P4: GCTAGC GTAGATCTAAGGCATCAAGGC

[0055] Using the cancer tissue samples of hepatitis B positive liver cancer patients expressing AFP and HBsAg as a template, PCR amplification was carried out. Among them, P1 and P2 can amplify AFP gene fragments, and P3 and P4 can amplify HBsAg gene fragments. The AFP gene PCR product and the lentiviral expression vector pHAGE-CMV-MCS-IZsGreen were digested with BamH I and Xho I, and the AFP gene fragment and line...

Embodiment 2

[0060] Example 2 Culture of AFP-HBsAg modified DC combined with CIK

[0061] 1. Purification and concentration of pHAGE-AFP-HBsAg lentivirus

[0062] The lentiviral expression plasmid pHAGE-AFP-HBsAg, the packaging plasmid psPAX2 and the envelope plasmid pMD2G were respectively extracted with a plasmid extraction kit, and the concentration of the plasmid was measured by a spectrophotometer. The three plasmids were transfected with calcium phosphate at a mass ratio of 3:2:2. 293T cells were co-transfected with the staining reagent. Collect the virus supernatant in 15ml tubes at 72 hours after transfection, centrifuge at 500G for 10min at 4°C, transfer the supernatant to a new 15ml tube, filter the virus supernatant with a 0.45μm filter; filter the virus supernatant at 4°C, 26000r / min ultracentrifugation for 4 hours, discard the supernatant, and dissolve the pellet in Gibco AIM-V serum-free medium pre-cooled at 4°C overnight to obtain the pHAGE-AFP-HBsAg virus concentrate, whi...

Embodiment 3

[0079] Example 3 In vitro killing of liver cancer cells by DC-CIK

[0080] Take the liver cancer cells HepG2.215 and common liver cancer cells HepG2 stably expressing hepatitis B surface antigen, pre-stain with carboxyfluorescein succinimide (CFSE), and modify the DC-CIK cells with the AFP-HBsAg prepared in Example 2 the next day Co-cultivation was carried out at a ratio of 1:5, 1:10, 1:20, and after 4 hours of co-cultivation, PI was stained. Cell apoptosis was detected by flow cytometry, and the amount of cell death was calculated according to the following formula: death rate=(control-sample) / control×100%, and the control was tumor cells without adding DC-CIK: the sample was adding DC - CIK tumor cells, such as Figure 7 Shown: AFP-HBsAg modified DC-CIK cells have extremely high specific killing activity on hepatitis B-positive liver cancer cells HepG2.215 and common liver cancer cells HepG2, respectively reaching 97.8 ± 10.2% and 78.5±12.3%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biotechnology, and particularly relates to a DC (Dendritic cell)-CIK (Cytokine-induced killer cell) immune cell modified by both AFP (Alpha-fetoprotein)and HBsAg (Hepatitis B surface antigen) antigen genes as well as a preparation method and application of the cell. The preparation method provided by the invention comprises the following steps: firstly constructing a recombinant plasmid pHAGE-AFP-HBsAg; then the recombinant plasmid pHAGE-AFP-HBsAg, a helper plasmid psPAX2 and pMD2G being co-transfected to 293T cells with calcium phosphate transfection reagent, to obtain recombinant lentivirus AFP-HBsAg; subsequently, infecting DC cells with the recombinant lentivirus AFP-HBsAg, to obtain the DC cells modified by the AFP-HBsAg; and finally, co-culturing the DC cells modified by the AFP-HBsAg with the CIK cells, to obtain the DC-CIK immune cells.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a DC combined with CIK immune cells modified with double antigens of AFP and HBsAg, and a preparation method and application thereof. Background technique [0002] Hepatocellular carcinoma (HCC) is a major disease that seriously threatens human health. It is one of the most common types of cancer in the cancer spectrum and ranks third among tumor-related death factors worldwide. There are more than 60 deaths worldwide each year million new cases. The occurrence of liver cancer is closely related to hepatitis B virus (Hepatitis B virus, HBV) infection. Since my country is a country with a high incidence of hepatitis B virus infection, the incidence of liver cancer in my country is much higher than the world average. About 110,000 people die of HBV in my country every year. liver cancer. At present, there are more than 350 million chronically infected people with hepatitis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/85A61K35/17A61P35/00
CPCA61K35/17A61P35/00C07K14/02C07K14/4715C12N5/0639C12N5/0645C12N2510/00
Inventor 胡钦勇
Owner 武汉大学人民医院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap