Molecular Marker and Its Application of Melon Female Flower Regulation Gene g
A technology of melon and unisexual flowers, which is applied in the field of agricultural biology, can solve the troublesome and complicated problems of breeding all females, and achieve the effect of improving breeding effect, saving time and cost, and clear breeding selection goals
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1, G gene specific marks development and detection of progeny groups
[0051] First, G gene specific mark development
[0052] According to the location of the G gene, labeled G-FR, the label consists of the primers shown in the primers shown and the primers shown in Sequence 2, ie the G gene specific marks.
[0053] Primer F: AAGGTACTCAAATGAATGGGCT (Sequence 1);
[0054] Primers R: TTAATCGGGTCGGTTCGGT (Sequence 2).
[0055] Second, the establishment of G gene specific mark detection method
[0056] The melon material B15 is the type of all-gender strain, and the whole straam is only a type, which has identified the genotype AAGG, which contains a G gene.
[0057] Melon Material 054 is the type of male whole, the vitality of life, and the mantles and full flowers have identified the genotype AAGG, ie contain a G gene.
[0058] 1, f 2 Gain of planting plants
[0059] In order to verify the accuracy and specificity of the marker G-FR, in the mother's B15 (a nest, Zhen...
Embodiment 2
[0088] Example 2, labeled G-FR in identifying the distribution of G genes in melon germplasm resources
[0089]In order to identify new all-sexual flower resources, the distribution of the G gene is understood, and the 34 part of the melon resource shown in Table 1 is detected by the G-FR mark. Take single-style flower materials 1520a and b24 (Hefei Pangren Agricultural Products Co., Ltd.) (known genotype GG) as a control.
[0090] If a PCR amplification product of 100-200 bp is obtained, the descendum of melon is contained or candidates containing a G gene; if the PCR amplification product of 100-200 bp is not obtained, the descendant of the melon does not contain or the candidate does not contain a G gene.
[0091] Such as image 3 And shown in Table 1, image 3 In the middle, lanes 1-36 are: melon materials B15, B18, 054, B1, B2, B3, B4, B, B6, B7, B8, B9, B10, B11, B12, B13, B14, B16, B17, B19 HP1, HP2, HP3, HP4, HP5, HP6, HP7, HP8, HP9, HP10, HP11, HP12, H71, H72, 1520A, B24; M...
Embodiment 3
[0098] Example 3, the application of Mark G-FR in the cultivation of melon full trays
[0099] In order to rapidly cultivate a genotype full of melon, a conventional hybridization and return breeding method were used to supplemented with molecular markers of the G gene.
[0100] 1, parental choice
[0101] Melon B15 (a nest monkey, Zhengzhou Xingyuan Piece Co., Ltd.), all-Chinese flower materials, genotypes are AAGG, provide G gene; B8 (Yang fang, Beijing Research ", male flower The gender flower materials, genotypes are AAGG, reincarnation parents; B24 (Huang Zijinyu, Hefei Pang's Agricultural Products Co., Ltd.), male and female (single flower) material, genotype is AAGG, providing a gene.
[0102] 2. Method of breeding method for genetic background with melon b8
[0103] First, as a cantaloupe B15, B24 is sexually hybridized to obtain f 1 Generation seed, plant f 1 Production plants, extract the marshopper strain, the single strain (at this time the genotype is AAGG); use the o...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap