Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular Marker and Its Application of Melon Female Flower Regulation Gene g

A technology of melon and unisexual flowers, which is applied in the field of agricultural biology, can solve the troublesome and complicated problems of breeding all females, and achieve the effect of improving breeding effect, saving time and cost, and clear breeding selection goals

Active Publication Date: 2021-10-01
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the sex type inheritance of muskmelon is relatively complicated, the genotype of the all female line is AAgg. During the breeding process of the all female line, the A gene is dominant and can still be observed through contemporary phenotypes, while the g gene is recessive and can only be observed automatically. Observing the phenotype of the offspring, therefore, it is laborious and laborious to select and breed all female lines by conventional crossing methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular Marker and Its Application of Melon Female Flower Regulation Gene g
  • Molecular Marker and Its Application of Melon Female Flower Regulation Gene g
  • Molecular Marker and Its Application of Melon Female Flower Regulation Gene g

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1, G gene specific marks development and detection of progeny groups

[0051] First, G gene specific mark development

[0052] According to the location of the G gene, labeled G-FR, the label consists of the primers shown in the primers shown and the primers shown in Sequence 2, ie the G gene specific marks.

[0053] Primer F: AAGGTACTCAAATGAATGGGCT (Sequence 1);

[0054] Primers R: TTAATCGGGTCGGTTCGGT (Sequence 2).

[0055] Second, the establishment of G gene specific mark detection method

[0056] The melon material B15 is the type of all-gender strain, and the whole straam is only a type, which has identified the genotype AAGG, which contains a G gene.

[0057] Melon Material 054 is the type of male whole, the vitality of life, and the mantles and full flowers have identified the genotype AAGG, ie contain a G gene.

[0058] 1, f 2 Gain of planting plants

[0059] In order to verify the accuracy and specificity of the marker G-FR, in the mother's B15 (a nest, Zhen...

Embodiment 2

[0088] Example 2, labeled G-FR in identifying the distribution of G genes in melon germplasm resources

[0089]In order to identify new all-sexual flower resources, the distribution of the G gene is understood, and the 34 part of the melon resource shown in Table 1 is detected by the G-FR mark. Take single-style flower materials 1520a and b24 (Hefei Pangren Agricultural Products Co., Ltd.) (known genotype GG) as a control.

[0090] If a PCR amplification product of 100-200 bp is obtained, the descendum of melon is contained or candidates containing a G gene; if the PCR amplification product of 100-200 bp is not obtained, the descendant of the melon does not contain or the candidate does not contain a G gene.

[0091] Such as image 3 And shown in Table 1, image 3 In the middle, lanes 1-36 are: melon materials B15, B18, 054, B1, B2, B3, B4, B, B6, B7, B8, B9, B10, B11, B12, B13, B14, B16, B17, B19 HP1, HP2, HP3, HP4, HP5, HP6, HP7, HP8, HP9, HP10, HP11, HP12, H71, H72, 1520A, B24; M...

Embodiment 3

[0098] Example 3, the application of Mark G-FR in the cultivation of melon full trays

[0099] In order to rapidly cultivate a genotype full of melon, a conventional hybridization and return breeding method were used to supplemented with molecular markers of the G gene.

[0100] 1, parental choice

[0101] Melon B15 (a nest monkey, Zhengzhou Xingyuan Piece Co., Ltd.), all-Chinese flower materials, genotypes are AAGG, provide G gene; B8 (Yang fang, Beijing Research ", male flower The gender flower materials, genotypes are AAGG, reincarnation parents; B24 (Huang Zijinyu, Hefei Pang's Agricultural Products Co., Ltd.), male and female (single flower) material, genotype is AAGG, providing a gene.

[0102] 2. Method of breeding method for genetic background with melon b8

[0103] First, as a cantaloupe B15, B24 is sexually hybridized to obtain f 1 Generation seed, plant f 1 Production plants, extract the marshopper strain, the single strain (at this time the genotype is AAGG); use the o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker of the melon female flower regulation gene g and its application. The primer pair of the present invention is a primer pair capable of amplifying a target sequence; the target sequence is the following 1) or 2): 1) a single-stranded DNA molecule shown in sequence 3 of the sequence listing; 2) sequence 3 is passed through one or A DNA molecule having the same function as sequence 7 with several nucleotide substitutions and / or deletions and / or additions. Utilize the molecular markers provided by the present invention and their corresponding primers to carry out polymerase chain reaction on the total DNA of the melon genome, and after electrophoresis detection of the amplified products, it can be judged whether the single plant to be detected carries the g gene, and the band specificity is good , the result is highly accurate, and the detection is not affected by the environment and genetic background. The invention can screen and identify the female flower regulating gene g in a large amount of melon germplasm resources, can be used for the cultivation of all-female lines of the melon, and can be applied in molecular marker-assisted selection breeding and gene aggregation breeding.

Description

Technical field [0001] The invention belongs to the field of agricultural biological technology, and specifically, a molecular marker and its application thereof of melon female flower regulation gene G. Background technique [0002] Cucumis Melo L.) is cucumis cucumber cucumber, a year of herbal plants, because of its fruit, rich in nutrient, and is well received by people. There is a gender differentiation in melon, and the main flowers are divided into three types: male flowers, female flowers and complete flowers. Different sputum combinations make melon's sexual types, which is roughly divided into the following: maiden floral strains (全 同, Andromonoecious), female flowers, same strain (GynomonoEcious), female Flowers (monoquin, monoecious), gender strains (complete strains, Hermaphrodite), female flowers and ribbon gender strains (trimoecious), full females (Gynoecious) and all-rosin (Androecious) Empty, etc., 2013). [0003] Studies have shown that the sex of melon is main...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11A01H1/02A01H1/04
CPCA01H1/02A01H1/04C12Q1/6895C12Q2600/13C12Q2600/156
Inventor 王建设马建
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES