Recombinant TM4 bacteriophage library for constructing NADH dehydrogenase gene family deleted mycobacterium tuberculosis and application thereof
A Mycobacterium tuberculosis and phage library technology, applied in the field of tuberculosis, can solve the problems of affecting autophagic cell apoptosis, affecting the growth and virulence of Mycobacterium tuberculosis, and achieve the effect of good knockout specificity and high positive rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] The design of embodiment 1 knockout primers
[0073] According to Mycobacterium tuberculosis NADH dehydrogenase family genes (Rv0392c, Rv1854c, Rv3145, Rv3146, Rv3147, Rv3148, Rv3149, Rv3150, Rv3151, Rv3152, Rv3153, Rv3154, Rv3155, Rv3156, Rv3158) gene group in Mycobacterium tuberculosis Select the appropriate fragment length on the selected target sequence as the position of the left and right homology arms to design primers (about 600-1000bp) and synthesize them, and further screen the following knockout primers according to the amplification and knockout effects.
[0074] Rv0392c:
[0075] Left arm upstream primer Rv0392cLF: GTCGGTGGCATACAACTGGG (SEQ ID NO: 1),
[0076] Left arm downstream primer Rv0392cLR: GGTGGGTCGTTGTCTTGGAG (SEQ ID NO: 2),
[0077] Right arm upstream primer Rv0392cRL: CCTGGTCTACCTGGTCGGCTAT (SEQ ID NO: 3),
[0078] Right arm downstream primer Rv0392cRR: AAGTGGTGCTGGACAACG (SEQ ID NO: 4);
[0079] Rv1854c:
[0080] Left arm upstream primer Rv...
Embodiment 2
[0171] Example 2 Construction of the recombinant shuttle vector library required for knocking out the Mycobacterium tuberculosis NADH dehydrogenase gene family phage library
[0172] Using the primer combination in Example 1, a recombinant shuttle vector library (the recombinant shuttle vector library required for knocking out the Mycobacterium tuberculosis NADH dehydrogenase gene family phage library) was constructed.
[0173] 1. Using Mycobacterium tuberculosis H37Rv as a template, using the primer combination in Example 1 as a primer and adding a corresponding restriction site at the 5' end, using KOD high-fidelity enzyme for PCR, and over-amplifying the corresponding fragments respectively.
[0174] Among them, the amplification of the left and right arms is carried out according to the following system:
[0175]
[0176] KOD PCR reaction conditions are:
[0177]
[0178] After the completion of PCR, 1% agarose gel electrophoresis was performed, and gel recovery was p...
Embodiment 3
[0182] Example 3 Construction of phage library for knocking out Mycobacterium tuberculosis NADH dehydrogenase gene family
[0183] The shuttle vector obtained in Example 2 was electrotransfected into Mycobacterium smegmatis to obtain a recombinant phage integrated with a homology arm, and a high-titer recombinant phage was obtained through in vitro amplification.
[0184] The specific operation is:
[0185] 1. Prepare Mycobacterium smegmatis competent cells;
[0186] 2. The shuttle vector obtained in Example 2 was electrotransferred into Mycobacterium smegmatis competent cells;
[0187] 3. The Mycobacterium smegmatis after electroporation is spread on the resistance selection medium containing hygromycin;
[0188] 4. Pick phage plaques, infect freshly cultured Mycobacterium smegmatis, and collect phage lysates.
[0189] Results: Phage plaques were grown successfully. After picking the plaques and infecting Mycobacterium smegmatis, high-titer phages were obtained from the co...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


