High-efficiency inducible expression system of Bacillus subtilis based on artificial tandem promoter

A promoter and gene expression technology, applied in the field of genetic engineering, can solve the problems of inability to construct an efficient inducible exogenous gene expression system, inhibitory activity, incompatibility, etc., and achieve the effect of simple structure, strict regulation and high activity

Active Publication Date: 2021-03-02
JIANGNAN UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, highly active promoters are often unable to be used to construct highly inducible exogenous gene expression systems, mainly because promoters are often incompatible with other elements of the gene expression regulation system, and highly active promoters are often unable to be effectively inhibited by repressor proteins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficiency inducible expression system of Bacillus subtilis based on artificial tandem promoter
  • High-efficiency inducible expression system of Bacillus subtilis based on artificial tandem promoter
  • High-efficiency inducible expression system of Bacillus subtilis based on artificial tandem promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Activity identification of artificial tandem promoters

[0028] P AWH-D30-106 ,P AH-D75-106 and P AH-D75-106 The promoters are artificially constructed core region tandem hybrid promoters.

[0029] P AWH-D30-106 ,P AH-D75-106 ,P AH-D75-106 The sequences of the promoters are respectively shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3.

[0030] Promoter P AWH-D30-106 The expression cassette of sfGFP (Genbank ID: AVR55189.1) was cloned into the pHT01 vector with the primers in Table 1, and the P on the original vector was replaced spac promoter sequence. The expression vector was transformed into Bacillus subtilis 168, the recombinant bacteria were cultured for 20 h, and the expression level of sfGFP was detected. In the same way, detect P AH-D75-106 and containing P WAH-D75-106 The expression level of sfGFP in the recombinant bacterial culture medium of the recombinant plasmid.

[0031] After comparing with the commonly used strong constitutive ...

Embodiment 2

[0036] Embodiment 2: Construction and characterization of IPTG inducible expression system

[0037]The binding site sequence of lacI is GGAATTGTGAGCGGATAACAATTCC (SEQ ID NO.4), which is designed in the primer P in Table 3 AWH -lacO-1 / P AWH - On lacO-2, the LacI protein binding site was cloned into the promoter P using the whole-plasmid PCR method AWH-D30-106 Downstream of the transcription start site, the repressor protein LacI is expressed by using the lacI module itself on the pHT01 vector backbone, so that an IPTG-inducible expression system is constructed ( figure 2 a).

[0038] Using sfGFP as the target protein to characterize the expression level, the plasmid pHT-AWH-lac-sfGFP was constructed. The recombinant plasmid was transformed into Bacillus subtilis 168, and the recombinant bacteria were cultured in LB medium at 37°C and 200 rpm, and the expression level of sfGFP was detected after 24 hours.

[0039] In the absence of an IPTG inducer, the repressor protein Lac...

Embodiment 3

[0044] Example 3: Construction and characterization of xylose-inducible expression system

[0045] The repressor XylR binding site was cloned into the promoter P using the primers in Table 3 AWH-D30-106 Downstream of the transcription initiation site, the lacI gene on the backbone of the pHT01 vector was replaced with the xylR gene to construct an XylR expression module, thus constructing an xylose-inducible expression system.

[0046] Using the plasmid pHT-AWH-lac-sfGFP as a template, the vector backbone was amplified with primers PAWH-xylR-v1 / PAWH-xylR-v2 (Table 5), and xylR was amplified with primers PAWH-xylR-i1 / PAWH-xylR-i2 Gene, recombine the amplified two fragments to obtain a plasmid in which lacI is replaced by xylR, and then use primers PAWH-xylO-1 / PAWH-xylO-2 to replace the binding site of lacI with the binding of xylR by the method of whole plasmid PCR The site AGTTAGTTTATTGGATAAACAAACTAACT (SEQ ID NO.5) was finally constructed to obtain the plasmid pHT-AWH-xyl-sf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-efficiency induced expression system of Bacillus subtilis based on an artificial tandem promoter, belonging to the technical field of genetic engineering. The present invention utilizes a high-efficiency artificial tandem constitutive promoter, and through the combined design of the promoter and operator-related elements (repressor protein and its binding site), the activity of the constitutive promoter is regulated by the inducer , and finally constructed the high-efficiency inducible expression system of Bacillus subtilis induced by the inducer. The results showed that compared with the P43 strong constitutive promoter, the activity of the artificial tandem promoter in this system was about 15 times higher. And the promoter activity can be precisely controlled by adding different concentrations of inducers. Therefore, the high-efficiency expression system has simple structure, high activity, and strict regulation, and has broad application prospects in the high-efficiency expression of heterologous proteins and synthetic biology research.

Description

technical field [0001] The invention relates to a high-efficiency induced expression system of Bacillus subtilis based on an artificial tandem promoter, belonging to the technical field of genetic engineering. Background technique [0002] Bacillus subtilis is a Gram-positive model strain widely used to express foreign proteins, and it is widely used in the production of industrial enzyme preparations because of its high-efficiency expression of foreign proteins. The promoter is the most basic element for constructing a high-efficiency expression system, and the activity of the promoter directly determines the efficiency of the expression system. Promoters are mainly divided into two types: constitutive promoters and inducible promoters. Constitutive promoters can express foreign genes at all stages of bacterial growth, while inducible promoters show no activity or low activity when they are not induced. source gene. Inducible promoters are widely used because of their co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/75C12N1/21C12R1/125
CPCC12N15/75C12R2001/125C12N1/205C12N2800/101C12N2830/002C12N2830/005C12N2830/006
Inventor周哲敏崔文璟郝文亮韩来闯周丽刘中美燕宇
OwnerJIANGNAN UNIV