High-efficiency inducible expression system of Bacillus subtilis based on artificial tandem promoter
A promoter and gene expression technology, applied in the field of genetic engineering, can solve the problems of inability to construct an efficient inducible exogenous gene expression system, inhibitory activity, incompatibility, etc., and achieve the effect of simple structure, strict regulation and high activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1: Activity identification of artificial tandem promoters
[0028] P AWH-D30-106 ,P AH-D75-106 and P AH-D75-106 The promoters are artificially constructed core region tandem hybrid promoters.
[0029] P AWH-D30-106 ,P AH-D75-106 ,P AH-D75-106 The sequences of the promoters are respectively shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3.
[0030] Promoter P AWH-D30-106 The expression cassette of sfGFP (Genbank ID: AVR55189.1) was cloned into the pHT01 vector with the primers in Table 1, and the P on the original vector was replaced spac promoter sequence. The expression vector was transformed into Bacillus subtilis 168, the recombinant bacteria were cultured for 20 h, and the expression level of sfGFP was detected. In the same way, detect P AH-D75-106 and containing P WAH-D75-106 The expression level of sfGFP in the recombinant bacterial culture medium of the recombinant plasmid.
[0031] After comparing with the commonly used strong constitutive ...
Embodiment 2
[0036] Embodiment 2: Construction and characterization of IPTG inducible expression system
[0037]The binding site sequence of lacI is GGAATTGTGAGCGGATAACAATTCC (SEQ ID NO.4), which is designed in the primer P in Table 3 AWH -lacO-1 / P AWH - On lacO-2, the LacI protein binding site was cloned into the promoter P using the whole-plasmid PCR method AWH-D30-106 Downstream of the transcription start site, the repressor protein LacI is expressed by using the lacI module itself on the pHT01 vector backbone, so that an IPTG-inducible expression system is constructed ( figure 2 a).
[0038] Using sfGFP as the target protein to characterize the expression level, the plasmid pHT-AWH-lac-sfGFP was constructed. The recombinant plasmid was transformed into Bacillus subtilis 168, and the recombinant bacteria were cultured in LB medium at 37°C and 200 rpm, and the expression level of sfGFP was detected after 24 hours.
[0039] In the absence of an IPTG inducer, the repressor protein Lac...
Embodiment 3
[0044] Example 3: Construction and characterization of xylose-inducible expression system
[0045] The repressor XylR binding site was cloned into the promoter P using the primers in Table 3 AWH-D30-106 Downstream of the transcription initiation site, the lacI gene on the backbone of the pHT01 vector was replaced with the xylR gene to construct an XylR expression module, thus constructing an xylose-inducible expression system.
[0046] Using the plasmid pHT-AWH-lac-sfGFP as a template, the vector backbone was amplified with primers PAWH-xylR-v1 / PAWH-xylR-v2 (Table 5), and xylR was amplified with primers PAWH-xylR-i1 / PAWH-xylR-i2 Gene, recombine the amplified two fragments to obtain a plasmid in which lacI is replaced by xylR, and then use primers PAWH-xylO-1 / PAWH-xylO-2 to replace the binding site of lacI with the binding of xylR by the method of whole plasmid PCR The site AGTTAGTTTATTGGATAAACAAACTAACT (SEQ ID NO.5) was finally constructed to obtain the plasmid pHT-AWH-xyl-sf...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com