Use of lnc-talc as a molecular marker in evaluating the efficacy and prognosis of glioblastoma TMZ chemotherapy
A glioblastoma, application technology, applied in the field of medicine, can solve problems such as unpredictable patients
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 The IC50 of drug-resistant glioblastoma cells TMZ was significantly increased
[0032] IC50 refers to the concentration at which the measured drug induces half of the tumor cells to die. The IC50 value can be used to measure the ability of the drug to induce apoptosis. Cell tolerance to drugs. Temozolomide IC50 values were calculated using cell growth curves for glioblastoma cell lines LN229 and U251 and primary cells 551W and HG7. The 1 / 50 IC50 concentration of each cell was used as the initial concentration, and the TMZ concentration was doubled and increased in 15 days as a cycle until 5 months, and drug-resistant glioblastoma cells 229R, 251R, 551WR and HG7R were successfully induced.
[0033] The experimental method is as follows: Glioblastoma cells were cultured in a 96-well plate, and when they were 70-80% confluent, the cells were treated with temozolomide at concentrations of 0 μM, 25 μM, 50 μM, 100 μM, 200 μM, and 400 μM for 72 hours, and then 10 ...
Embodiment 2
[0035] Screening and identification of embodiment 2lnc-TALC
[0036] Using the lncRNA chip to analyze the lncRNA level of the successfully constructed drug-resistant glioblastoma cell 229R and the parental cell LN229, the hybridization and analysis of the lncRNA chip were provided by Shanghai Bohao Biological Company. The microarray results showed that there was a significant difference in lncRNA expression levels between drug-resistant glioblastoma cells and parental cells, and the inventors selected 10 lncRNAs with the largest up-regulation differences in drug-resistant glioblastoma cells, respectively in LN229 / 229R , U251 / 251R, 551W / 551WR, HG7 / HG7R four groups of cells extracted RNA verified by qPCR ( figure 2 ).
[0037] In order to verify whether these lncRNAs play a role in glioblastoma TMZ drug resistance, the inventors used the siDirect website (http: / / sidirect2.rnai.jp / ) to design siRNA sequences and entrusted Shanghai Jikai Gene Company to synthesize them (Table 1 )...
Embodiment 3
[0041] Example 3 High expression of lnc-TALC in the tissues of patients with recurrent glioblastoma
[0042] The expression levels of lnc-TALC in tissue samples from 79 clinically recurrent glioblastoma patients and primary glioblastoma patients were evaluated by qPCR and ISH techniques.
[0043] 1. The sequence of lnc-TALC:
[0044] Use the Ensemble database to query the full-length sequence of lnc-TALC, which includes 2 exons and 328 bases, and the sequence is shown in SEQ ID NO.5.
[0045] 2. Design lnc-TALC primers
[0046] For the sequence of lnc-TALC, the forward and reverse primers of qPCR were designed using the Primer Blast website, and the primers were synthesized by Unionwell.
[0047] Forward primer (5'-3'): TTTGAAATGCTCTTTGAGGGAT (SEQ ID NO.1)
[0048] Reverse primer (5'-3'): TGCAGGTTGTCTGAAGTTGGA (SEQ ID NO.2)
[0049] 3. Extract the total RNA in clinical primary and recurrent glioblastoma tissues, and use qPCR and ISH techniques to detect the expression leve...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com