Key enzyme genes ak2 and dhps1 of lysine synthesis pathway modified by site-directed mutagenesis and their application

A site-directed mutagenesis and synthase technology, applied in the fields of molecular biology and biology, can solve problems such as negative effects and health hazards, and achieve the effects of enriching germplasm resources, realizing targeted genetic improvement, and avoiding unintended effects.

Active Publication Date: 2022-04-22
YANGZHOU UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although insensitivity or low sensitivity to lysine feedback inhibition have been obtained in species such as Escherichia coli, barley and maize AK and DHPS Genes, and some high-lysine transgenic plants have been obtained through genetic engineering techniques, but rice, as an important food crop, has not been found to be insensitive to lysine feedback inhibition AK and DHPS The existence of gene, at the same time, the exogenous gene that transfers to other species in the plant has certain negative effects and health hazards, so the present invention transforms rice endogenous AK and DHPS Gene, in order to achieve the purpose of increasing the lysine content in rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Key enzyme genes ak2 and dhps1 of lysine synthesis pathway modified by site-directed mutagenesis and their application
  • Key enzyme genes ak2 and dhps1 of lysine synthesis pathway modified by site-directed mutagenesis and their application
  • Key enzyme genes ak2 and dhps1 of lysine synthesis pathway modified by site-directed mutagenesis and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Obtaining rice by site-directed mutation technique AK2 with DHPS1 Genes and their applications.

[0042] aspartokinase mutant gene AK2 and dihydropicolinic acid synthase mutant gene DHPS1 the acquisition

[0043] Using the cDNA of rice Wuyujing 9 as a template to amplify rice endogenous aspartokinase gene by PCR AK , the primers used are AK-forward: 5’ AGGATCCATGGCGATCGCTCTCCGATT 3’ and

[0044] AK-Reverse: 5'AGAGCTCTCAGCTCATGTGAAGGGCTT 3',

[0045] PCR amplification of rice endogenous DHPS gene, the primers used were

[0046] DHPS-Forward: 5’ AGGATCCATGCA ACACTCTGACACAG 3’ and

[0047] DHPS-Reverse: 5'AGAGCTCTTAATACCTACTGATCA AC 3'.

[0048] rice endogenous AK with DHPS After the gene is correctly identified by sequencing, the directional mutation is obtained by overlapping PCR technology AK2 with DHPS1 gene, the specific primers used in the overlap PCR method are respectively

[0049] AK2-Forward 5’TAGATTGTGTGGCTACTCTTGAAGTTAGTATTTCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the key enzyme gene of the lysine synthesis pathway transformed by site-directed mutation AK2 and DHPS1 The invention and its application belong to the fields of molecular biology and biotechnology. The present invention uses in vitro site-directed mutagenesis technology to obtain rice with two mutated bases AK2 gene, and rice with one base mutation DHPS1 Gene. Should AK2 The protein encoded by the gene has the amino acid sequence shown in SEQ ID NO 4, and the encoded gene has the nucleotide sequence shown in SEQ ID NO 3; the DHPS1 The protein encoded by the gene has the amino acid sequence shown in SEQ ID NO 8, and the encoded gene has the nucleotide sequence shown in SEQ ID NO 7. After the verification and analysis of transgenic rice, the modified AK2 and DHPS1 The gene can effectively increase the level of lysine in rice. The modified gene can be used for bioenhancement of lysine in rice.

Description

Technical field: [0001] The invention belongs to the field of molecular biology and biotechnology, and in particular relates to modified AK2 and DHPS1 genes capable of increasing the content of free lysine in rice and their application in the cultivation of high-lysine rice materials. Background technique: [0002] As a vital food crop, rice is rich in starch and high-quality rice protein, which provides energy and protein needed by humans and livestock. However, the content of lysine is low, which causes the absorption of other amino acids to be blocked, which in turn affects the effective utilization of rice protein, resulting in the imbalance of food nutritional components and dietary structure, so lysine is called the first limit in cereal crops Sexual amino acids (Shewry, J Cereal Sci, 2007, 3(46):239-250). Especially in developing countries where rice is the main food, protein-energy malnutrition has seriously affected the health of the human body (Millward, P Nutr So...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/12C12N9/88C12N15/54C12N15/60C12N15/82A01H5/00A01H5/10A01H6/46
CPCC12N9/1217C12N9/88C12N15/8254C12Y207/02004C12Y402/01
Inventor刘巧泉吴宏玉杨晴晴辛世文
OwnerYANGZHOU UNIV