Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing knock-out mouse model to analyze lethal gene function by utilizing CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated protein 9) system

A technology of model analysis and gene function, applied in the biological field, can solve the problems of inability to quickly realize lethal genes, cumbersome production steps, unfavorable research development, etc., and achieve the effect of long production cycle, cumbersome production steps and low operation difficulty

Inactive Publication Date: 2019-05-28
CAPITAL UNIVERSITY OF MEDICAL SCIENCES
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the production steps of this method are cumbersome, and the production period is long, the period is more than 2 years
Moreover, this method cannot quickly realize the screening of lethal genes without functions in tissues
Because when studying the functions of lethal genes in different tissues in adulthood, different Cre mice and floxed mice need to be bred and multiplied, which is cumbersome to operate and consumes a lot of resources, which is not conducive to research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing knock-out mouse model to analyze lethal gene function by utilizing CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated protein 9) system
  • Method for constructing knock-out mouse model to analyze lethal gene function by utilizing CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated protein 9) system
  • Method for constructing knock-out mouse model to analyze lethal gene function by utilizing CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated protein 9) system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] A method of using the CRISPR / Cas9 system to construct a systemic knockout mouse model of the postnatal lethal gene Slc17a5 that can be subcultured by microinjection of two-cell embryos. The present invention will be further described below in conjunction with specific examples.

[0057] 1.1 Construction of CRISPR-Cas9 system components

[0058] 1.1.1 Design of sgRNA sequence for gene knockout

[0059] (1) Enter the NCBI website and query the Gene ID of mouse Slc17a5: 235504.

[0060] (2) Enter https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-design website, enter Gene ID to find available sgRNA.

[0061] (3) Select the sgRNA according to the score given by the website. The higher the score, the lower the off-target effect and the better the specificity of the sgRNA. At the same time, the position of the sgRNA on the CDS should also be considered comprehensively. Use the domain architecture retrieval tool of NCBI to predict which important structural ...

Embodiment 2

[0196] A method of using the CRISPR / Cas9 system to construct a subcultured embryonic lethal gene Virma systemic knockout mouse model by microinjection of two-cell embryos. The present invention will be further described below in conjunction with specific examples.

[0197] 2.1 Construction of CRISPR-Cas9 system components

[0198] For detailed steps, refer to the method in 1.1, Gene ID of Virma: 66185. sgRNA sequence, sgRNA1 sequence is 5'-CUAUGGGCUCGUACUCCCGG-3' (SEQ ID NO.2).

[0199] Oligodeoxynucleotide (DNA oligo, 5'→3') synthesized by Sangon Biotech

[0200] sgRNA1F: taatacgactcactatagCTATGGGCTCGTACTCCCGGgtttaagagctatgctggaaa (SEQ ID NO. 7);

[0201] sgRNAR:aaaagcaccgactcggtgcc (SEQ ID NO.4)

[0202] Finally, the in vitro transcription and purification of Virma sgRNA1 and Cas9 mRNA were completed.

[0203] 2.2 Two-cell embryo microinjection and embryo transfer in mice

[0204] Detailed steps are with reference to the method of step 1.2 in embodiment 1

[0205] Virm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology and in particular relates to a method for constructing a knock-out mouse model to analyze a lethal gene function by utilizing a CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated protein 9) system. The method comprises the following steps: 1) designing an sgRNA (small guide Ribonucleic Acid) sequence forefficiently identifying a PAM region of a knocked-out lethal gene; 2) mixing Cas9 or protein of mRNA (micro Ribonucleic Acid) and sgRNA designed in step 1); carrying out microinjection on any one blastomere cell in a mouse two-cell embryo through a mixture; after injection is finished, transplanting the embryo and identifying strain genes to obtain a chimera positive mouse with the knocked-out lethal gene; 3) analyzing the function of the lethal gene in a tissue organ by utilizing a positive founder mouse. According to the technical scheme provided by the invention, compared with the prior artof specifically knocking out tissues based on a Cre / LoxP system, the method has a short manufacturing period and the period is only about 3 months.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for constructing a knockout mouse model by using a CRISPR / Cas9 system to analyze the function of a lethal gene. Background technique [0002] Knockout lethal genes have received special attention because they play important roles in the body. Studies predict that lethal genes account for about 23% of mouse genes (Cell, 2013, 154:452; Nature 2016, 537:508). Lethal genes after knockout refer to a class of genes whose systemic loss of gene function leads to the death of individuals during the embryonic period and after birth, including embryonic lethal genes and postnatal lethal genes, so it is impossible to study lethality through systemic knockout mouse models The function of genes in the adult body. [0003] Conditional gene knockout can avoid adult death of lethal gene knockout animals, that is, to knock out a specific gene in a specific tissue cell or a specific stage of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/90C12N9/22A01K67/027
Inventor 陈柏安仵毅王松灵张婧陈雨心
Owner CAPITAL UNIVERSITY OF MEDICAL SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com