Check patentability & draft patents in minutes with Patsnap Eureka AI!

Monoclonal antibody with effect of inhibiting fibrotic lesion of vitreum retina and preparation method and application of monoclonal antibody

A vitreoretinal, monoclonal antibody technology, applied in the direction of antibodies, sensory diseases, cardiovascular system diseases, etc., can solve problems limited to animal experiments, achieve excellent binding activity, prevent and treat proliferative vitreoretinal fibrosis. Effect

Pending Publication Date: 2019-05-31
HE UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing clinical commonly used drugs have many complications and side effects, and some other types of treatment methods are limited to the stage of animal experiments, and further clinical research is still awaited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monoclonal antibody with effect of inhibiting fibrotic lesion of vitreum retina and preparation method and application of monoclonal antibody
  • Monoclonal antibody with effect of inhibiting fibrotic lesion of vitreum retina and preparation method and application of monoclonal antibody
  • Monoclonal antibody with effect of inhibiting fibrotic lesion of vitreum retina and preparation method and application of monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0032] refer to figure 1 , the embodiment of the present invention provides a kind of preparation method of anti-human CTGF monoclonal antibody, comprising:

[0033] In step S10, the recombinant human CTGF antigen protein whose nucleic acid sequence is shown in SEQ ID NO:1 is obtained.

[0034] As an example, the method for obtaining recombinant human CTGF antigenic protein is as follows:

[0035] 1. By means of bioinformatics, the nucleic acid sequence of CTGF is retrieved in the NCBI database, as shown in SEQ ID NO:1. According to the nucleic acid sequence information, the DNA of CTGF is artificially synthesized.

[0036] 2. Using the DNA of the artificially synthesized CTGF as a template, carry out PCR amplification.

[0037] The PCR primers are as follows:

[0038] P1: GAATTCATGACCGCCGCCAGTATG

[0039] P2: GCGGCCGCTCATGCCATGTCTCCGTA

[0040] The PCR system is as follows: Ex Taq (5U / μL) 0.25 μL, 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5mM) 4 μL, Template 1 μL, upstream...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a monoclonal antibody with an effect of inhibiting fibrotic lesion of the vitreum retina and a preparation method and application of the monoclonal antibody. The monoclonal antibody is an anti-human CTGF monoclonal antibody, the antibody fragment of the anti-human CTGF monoclonal antibody comprises a single-chain variable fragment, Fab, Fab', F(ab')2 or a nanometer antibody.The monoclonal antibody can be specifically combined with CTGF in blood and body fluid in the human body to achieve the effect of inhibiting promotion of canaliculus formation from cells by the CTGF,therefore the fibrotic lesion of the vitreum retina is prevented and treated, and the monoclonal antibody is suitable for preparing a monoclonal antibody medicine for treating the fibrotic lesion ofthe vitreum retina.

Description

technical field [0001] The invention relates to the technical field of monoclonal antibodies, in particular to a monoclonal antibody capable of inhibiting vitreoretinal fibrosis and its preparation method and application. Background technique [0002] Connective tissue growth factor (CTGF) is an important cytokine that promotes the formation of fibrotic scar after tissue injury, and can be expressed in tissues and organs such as heart, brain, kidney, lung, liver and placenta. The human CTGF gene is located on the long arm of chromosome 6, including 5 exons and 4 introns, and its encoded protein is a cysteine-rich secretion composed of 349 amino acids with a molecular weight of 36-38kD. Peptides, which are closely related to transforming growth factor-β (TGF-β), can be considered as downstream response elements of TGF-β. In scar formation, organ fibrosis, atherosclerosis, systemic sclerosis, wound repair, and some benign and malignant tumors, CTGF expression is up-regulated ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/22A61K39/395A61P27/02A61P27/06A61P9/10
Inventor 张朔王卓实李雪娇张明琦张敏李怀超张鹏贾爽赵洪礼何向东何伟
Owner HE UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More