Monoclonal antibody with effect of inhibiting fibrotic lesion of vitreum retina and preparation method and application of monoclonal antibody
A vitreoretinal, monoclonal antibody technology, applied in the direction of antibodies, sensory diseases, cardiovascular system diseases, etc., can solve problems limited to animal experiments, achieve excellent binding activity, prevent and treat proliferative vitreoretinal fibrosis. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0032] refer to figure 1 , the embodiment of the present invention provides a kind of preparation method of anti-human CTGF monoclonal antibody, comprising:
[0033] In step S10, the recombinant human CTGF antigen protein whose nucleic acid sequence is shown in SEQ ID NO:1 is obtained.
[0034] As an example, the method for obtaining recombinant human CTGF antigenic protein is as follows:
[0035] 1. By means of bioinformatics, the nucleic acid sequence of CTGF is retrieved in the NCBI database, as shown in SEQ ID NO:1. According to the nucleic acid sequence information, the DNA of CTGF is artificially synthesized.
[0036] 2. Using the DNA of the artificially synthesized CTGF as a template, carry out PCR amplification.
[0037] The PCR primers are as follows:
[0038] P1: GAATTCATGACCGCCGCCAGTATG
[0039] P2: GCGGCCGCTCATGCCATGTCTCCGTA
[0040] The PCR system is as follows: Ex Taq (5U / μL) 0.25 μL, 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5mM) 4 μL, Template 1 μL, upstream...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com