Construction method and application of human mitochondrial genome library

A technology of genome library and human mitochondria, which is applied in the field of life science and biology, can solve the problems of increased false negatives and strict PCR amplification conditions, and achieve the effects of saving time, avoiding false positives and false negatives, and relieving pain

Active Publication Date: 2019-06-04
ZHEJIANG UNIV
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this method can detect positive sites in a short period of time, the PCR amplification conditions are strict, and the probability of false negatives is greatly increased

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of human mitochondrial genome library
  • Construction method and application of human mitochondrial genome library
  • Construction method and application of human mitochondrial genome library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 A method and kit for constructing a human mitochondrial genome library

[0033] The chip kit provided by the present invention includes two-stage specific primers for the full sequence of mitochondrial DNA amplified by a one-step method, probe components required for multiplex PCR in three reaction pools, and a specific chip for performing mitochondrial universal adapters Consists of 3 components. in,

[0034] (1) The full length of mitochondrial DNA needs to be amplified before the SNP detection of mitochondrial DNA. Due to fresh samples and old samples, it cannot be fully amplified. We use a two-stage method to amplify the entire mitochondrial DNA; The mitochondrial DNA amplification primers are: sample forward primer 1: AAATCTTACCCCGCCTGTTT (SEQ: NO.1), reverse primer 1: AATTAGGCTGTGGGTGGTTG (SEQ: NO.2); forward primer 2: GCCATAC TAGTCTTTGCCGC (SEQ: NO. 3), reverse primer 2: GGCAGGTCAATTTCACTGGT (SEQ: NO.4);

[0035] (2) The probe components needed for t...

Embodiment 2

[0039] Embodiment 2 Mitochondrial library chip making and analysis

[0040] according to figure 1 The schematic diagram shown, the library construction preparation before the complete mitochondrial DNA sequence determination is as follows:.

[0041] Step 1: Mitochondrial sequence amplification and purification: use the two-stage method to amplify the entire mitochondrial DNA; two mitochondrial DNA amplification primers with overlapping characteristics perform the following reactions: (1) The reaction system is: The reaction system is: ddH2O (10.25-x) μl; 2X high GC-Melt LA buffer 12.5μl, dNTP (10mM) 1μl, primer (F / R) 0.5μl, gDNA (100ng / μl) xμl, high GC Genomic LA polymerase (5units / ml) 0.25μl; (2) The reaction conditions are: pre-denaturation temperature and time 94°C, time 1min, denaturation temperature and time 94°C 30s, annealing temperature and time 56°C 30s, extension temperature and time 72°C 9min, a total of 30 Cycle; final extension temperature and time 72°C 5min; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to view more

Abstract

The present invention provides a construction method and an application of a human mitochondrial genome library. Aiming at characteristics of a mitochondrial genome, a two-stage method is used to amplify whole mitochondrial DNA for new and old samples; two mitochondrial DNA amplification primers with overlapping characteristics amplify full-length of mitochondria to increase fidelity, then according to probe components required for multiplex PCR in 3 reaction cells, the number of the probes of each reaction cell are 33 pairs respectively for mitochondrial whole genome capture, and specific chips of biotin-labeled mitochondrial universal connectors of the different samples are utilized to conduct amplification of an oligonucleotide mixture to form the biotin-labeled mitochondrial DNA probelibrary. The construction method realizes use of a high-throughput screening method and application, is faster, more economical and simpler than relatively single site generation sequencing detection,has low requirements on equipment and environment, and is favorable for promotion and application, and suitable for large-scale screening and preventive examination of populations related to deafness.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and specifically relates to a method and application for constructing a human mitochondrial genome library. Background technique [0002] Mitochondria are organelles in eukaryotic cells ranging in diameter from 0.5 to 10 micrometers (μm). Mitochondria can produce most of the adenosine triphosphate (ATP) that supplies the cell as chemical energy, so it is called the "power factory" of the cell. In addition to providing cellular energy, mitochondria are involved in a range of other cellular functions, such as signal transduction, cell differentiation, apoptosis, and regulation of the cell cycle and cell growth. Mitochondria are also the main place where free radicals are produced in cells. Mitochondrial dysfunction is associated with a variety of human diseases, such as: maternally inherited diseases (such as maternally inherited deafness, Leber hereditary optic neuropathy and other ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10C12Q1/6806C12Q1/6883C40B50/06
Inventor 冀延春管敏鑫蒋萍萍高应龙毛琴
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap