Construction method and application of human mitochondrial genome library
A technology of genome library and human mitochondria, which is applied in the field of life science and biology, can solve the problems of increased false negatives and strict PCR amplification conditions, and achieve the effects of saving time, avoiding false positives and false negatives, and relieving pain
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 A method and kit for constructing a human mitochondrial genome library
[0033] The chip kit provided by the present invention includes two-stage specific primers for the full sequence of mitochondrial DNA amplified by a one-step method, probe components required for multiplex PCR in three reaction pools, and a specific chip for performing mitochondrial universal adapters Consists of 3 components. in,
[0034] (1) The full length of mitochondrial DNA needs to be amplified before the SNP detection of mitochondrial DNA. Due to fresh samples and old samples, it cannot be fully amplified. We use a two-stage method to amplify the entire mitochondrial DNA; The mitochondrial DNA amplification primers are: sample forward primer 1: AAATCTTACCCCGCCTGTTT (SEQ: NO.1), reverse primer 1: AATTAGGCTGTGGGTGGTTG (SEQ: NO.2); forward primer 2: GCCATAC TAGTCTTTGCCGC (SEQ: NO. 3), reverse primer 2: GGCAGGTCAATTTCACTGGT (SEQ: NO.4);
[0035] (2) The probe components needed for t...
Embodiment 2
[0039] Embodiment 2 Mitochondrial library chip making and analysis
[0040] according to figure 1 The schematic diagram shown, the library construction preparation before the complete mitochondrial DNA sequence determination is as follows:.
[0041] Step 1: Mitochondrial sequence amplification and purification: use the two-stage method to amplify the entire mitochondrial DNA; two mitochondrial DNA amplification primers with overlapping characteristics perform the following reactions: (1) The reaction system is: The reaction system is: ddH2O (10.25-x) μl; 2X high GC-Melt LA buffer 12.5μl, dNTP (10mM) 1μl, primer (F / R) 0.5μl, gDNA (100ng / μl) xμl, high GC Genomic LA polymerase (5units / ml) 0.25μl; (2) The reaction conditions are: pre-denaturation temperature and time 94°C, time 1min, denaturation temperature and time 94°C 30s, annealing temperature and time 56°C 30s, extension temperature and time 72°C 9min, a total of 30 Cycle; final extension temperature and time 72°C 5min; ...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap