Method for identifying microbial gene functions on basis of inducible promoters
A gene function and promoter technology, applied in the field of genetic engineering, can solve the problems of universality without experimental proof, poor universality, and inability to perform two kinds of analysis at the same time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0164] Example 1: ZMO1360 mutant strain was constructed by replacing the ZMO1360 promoter.
[0165] (1) The promoter selects the intergenic sequence in front of the gene
[0166] 5’-AAAAGTCTTTTTCGCTTCGGCAGAAGAGGTTCATCATGAACAAAAATTCGGCATTTTTAAAAATGCCTATAGCTAAATCCGGAACGACACTTTAGAGGTTTCTGGGTCATCCTGATTCAGACATAGTGTTTTGAATATATGGAGTAAGCA-3’, in the Operon and Gene Finding in Bacteria functional area on the Softberry website ( http: / / www.softberry.com / berry.phtml? topic=bprom&group=programs&subgroup= gfindb ) to obtain the potential promoter sequence (the set promoter region has been marked above)
[0167] Promoter Pos: 120LDF-2.10
[0168] -10box at pos.105GGTCATCCT Score 36
[0169] -35box at pos.84ACGACA Score -1
[0170] (2) Specifically design 4 specific primers for the promoter of the target gene (genome 43518bp-43549bp),
[0171] Specific primers used to amplify the upstream and downstream homology arms, including:
[0172] Upstream front primer: 5'- AGGGATTTTGGTCATG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



