Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

pFC330-BEC plasmid capable of achieving base precise point mutation and application thereof

A pfc330-bec, point mutation technology, applied in the field of genetic engineering, to achieve the effect of broad application prospects

Pending Publication Date: 2019-07-02
SOUTH CHINA UNIV OF TECH
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, common problems with the CRISPR / Cas9 system (DSBs and need for donor DNA) remain during genetic engineering of filamentous fungi

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • pFC330-BEC plasmid capable of achieving base precise point mutation and application thereof
  • pFC330-BEC plasmid capable of achieving base precise point mutation and application thereof
  • pFC330-BEC plasmid capable of achieving base precise point mutation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Construction of pFC330-BEC recombinant plasmid (pFC330-BEC plasmid) by gene recombination

[0035] The primer sequences used in Example 1 are shown in Table 1 (synthesized at Guangzhou Tianyi Huiyuan Biotechnology Co., Ltd.):

[0036] Table 1

[0037]

[0038] The composition of pFC330-BEC recombinant plasmid is as follows figure 1 As shown, among them, BglII site: for inserting sgRNA fragment; Ptef: Aspergillus fumigatus derived tef1 gene promoter, used to drive fusion protein expression; AmpR: ampicillin resistance gene; ori: plasmid replicator in Escherichia coli ( origin of replication); pyrG: uracil auxotrophic marker; AMA1: filamentous fungal autonomous replication sequence; rAPOBEC1: codon-optimized cytosine deaminase; nCas9: Cas9 protein with amino acid mutation at position 10 (D10A); UGI: Uracil DNA glycosylase inhibitory protein.

[0039] The pFC330-BEC recombinant plasmid contains an expressible rAPOBEC1-nCas9-UGI gene fragment and a filament...

Embodiment 2

[0045] Example 2. The pFC330-BEC plasmid achieves efficient base editing in Aspergillus niger CBS513.88 strain:

[0046] The pFC330-BEC plasmid can be used to achieve efficient base editing of different genes in Aspergillus niger CBS513.88 strain. In the experiment, the prtT gene (protease regulatory gene prtT) of Aspergillus niger was selected as an example, and the base editing experiment was carried out in the Aspergillus niger CBS513.88 strain.

[0047] figure 2 It is a diagram of the sequencing results of base editing of the protease regulatory gene prtT in Aspergillus niger CBS513.88 strain using the pFC330-BEC plasmid in Example 2 of the present invention.

[0048] in figure 2 The DNA sequence (TTTGATTAAAAGCATCATCA) in the box is the protospacer sequence (20bp); the box above the sequencing map is the corresponding amino acid; the arrow indicates the mutation site; the right box is the amino acid position of the mutation and the corresponding transformant number. ...

Embodiment 3

[0073] Example 3. The pFC330-BEC plasmid achieves efficient base editing in Aspergillus niger FGSC1279 strain:

[0074] High-efficiency base editing of different genes can be achieved in Aspergillus niger FGSC1279 strain with pFC330-BEC plasmid. In the experiment, the pigment gene fwnA gene was selected as an example, and the base editing experiment was carried out in the Aspergillus niger FGSC1279 strain (see results in image 3 and Figure 4 ). image 3 The base mutation sequencing results of the fwnA gene in the Aspergillus niger FGSC1279 strain for the pFC330-BEC plasmid;

[0075] in image 3 The DNA sequence (GGTAATTGAGCATTTACGCC) in the box is the protospacer sequence (20bp); the box above the sequencing map is the corresponding amino acid; the arrow indicates the mutation site; the right box is the amino acid position of the mutation and the corresponding transformant number.

[0076] The arginine at position 557 was mutated into a stop codon by mutating the C at p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pFC330-BEC plasmid capable of achieving base precise point mutation and an application thereof. A nucleotide sequence of the pFC330-BEC plasmid is shown as SEQ ID NO: 3, which comprises a rAPOBEC1-XTEN-nCas9-UGI fusion gene fragment that can be expressed in aspergillus niger, an escherichia coli resistance gene fragment AmpR, a pyrG selection marker, a filamentous fungusautonomously replicating sequence AMA1, a promoter Ptef, and a plasmid replication origin ori. The plasmid can efficiently and rapidly mutate cytosine at any position on a filamentous fungal genome into thymine, and can achieve mutation of amino acid or inactivation of a gene. The plasmid has broad application prospects in molecular breeding, physiological characteristics, metabolites, host transformation and industrial production of filamentous fungi, and can provide a new technical platform for genetic engineering modification of the filamentous fungi.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a pFC330-BEC plasmid capable of realizing precise point mutation of bases and an application thereof. Background technique [0002] The CRISPR / Cas system with the property of precisely editing genomic DNA has brought a revolutionary impetus to the development of genetic engineering. Under the guidance of a single chimeric guide RNA (sgRNA), the endonuclease Cas9 is guided to a specific locus where it recognizes and cleaves a specific DNA sequence in a targeted manner, creating a double-strand break in the genome ( DSB). In cells, DSB mainly performs DNA double-strand repair through non-homologous end joining (NHEJ); in the presence of donor DNA, DSB can also activate homologous recombination repair (HDR) for accurate genetic modification, but It is less efficient than NHEJ in higher eukaryotic cells. Gene inactivation via DSBs readily induces in-frame indels in p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/80C12N1/15C12R1/685
CPCC12N15/80
Inventor 潘力黄良刚董宏智郑俊威王斌
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com