Chimonanthus praecox CpFT gene and application thereof
A technology of wintersweet and genes, applied in the field of genetic engineering, can solve the problems that wintersweet has no relevant reports, and achieve the effect of vegetative growth inhibition
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Cloning of embodiment 1 Wintersweet CpFT gene
[0030] 1 Primer design
[0031] According to the annotation information of the cDNA library of Wintersweet flower constructed in our laboratory, the cDNA sequence of the FT gene containing the complete ORF frame was detected. The experimental material of the cDNA library was Chimekou wintersweet planted in the school, and its flowers of different periods were used as materials to construct. Design specific primers according to the obtained cDNA sequence. The upstream and downstream primers contain the complete ORF sequence. The primer sequences are as follows:
[0032] CpFT-F CGTAGTCATCCAAGTATCTCAATC
[0033] CpFT-R TGGAACTGCTGTTGGACCTAT
[0034] The wax plum cDNA was used as a template, and the above-mentioned primers were used for PCR amplification, and a fragment of about 580 bp was amplified.
[0035]Recover the target fragment, connect it to T vector, construct the cloning vector, transform Escherichia coli compet...
Embodiment 2
[0036] Example 2 Analysis of Wintersweet CpFT Gene Expression
[0037] The roots, stems, cotyledons, young leaves, and mature leaves of Chimonanthus praecox (all collected from biennial Chimonanthus praecox seedlings, planted in the tissue culture room of the Flower Research Institute of Southwest University, under routine maintenance and management) and various flower organs Materials (all collected from adult wintersweet plants, planted on the campus of Southwest University, routine maintenance and management).
[0038] 1 Design and synthesis of real-time fluorescent quantitative PCR primers
[0039] The Actin and Tublin genes of Wintersweet were selected as the dual internal reference genes for real-time fluorescence quantification of the CpFT gene of Wintersweet. Primer Premier 5.0 software was used to design specific primers for the internal reference gene and the target gene CpFT, and then sent to Beijing Liuhe Huada Gene Technology Co., Ltd. Ltd Synthetics. All primer...
Embodiment 3
[0053] Example 3 Genetic Transformation and Functional Analysis of Wintersweet CpFT Gene in Arabidopsis
[0054] 1 Construction of CpFT gene plant overexpression vector
[0055] The CpFT gene was excised from the cloning vector, and then connected to the plant expression vector pCAMBIA2301G, and the plant overexpression vector pCAMBIA2301g-CpFT (or 35S::CpFT) of the Wintersweet CpFT gene was constructed. The vector schematic diagram is as follows Figure 4 shown.
[0056] 2 Transformation of Arabidopsis thaliana by flower bud infection
[0057] The transgenic recipient Arabidopsis thaliana (L.) Heynh was a wild Columbia type WT (Col-0), and its seeds were preserved by the Flower Research Institute of Southwest University.
[0058] 2.1 Culture of Arabidopsis
[0059] Take an appropriate amount of wild-type Arabidopsis WT seeds in a 1.5mL centrifuge tube, add a 17% sodium hypochlorite (NaClO) solution, fully oscillate and sterilize for 7 minutes, and then wash 5-6 times with ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com