Chimonanthus praecox CpFT gene and application thereof

A technology of wintersweet and genes, applied in the field of genetic engineering, can solve the problems that wintersweet has no relevant reports, and achieve the effect of vegetative growth inhibition

Active Publication Date: 2019-07-09
SOUTHWEST UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, multiple homologous genes of FT have been cloned, but there is no related report in Wintersweet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimonanthus praecox CpFT gene and application thereof
  • Chimonanthus praecox CpFT gene and application thereof
  • Chimonanthus praecox CpFT gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Cloning of embodiment 1 Wintersweet CpFT gene

[0030] 1 Primer design

[0031] According to the annotation information of the cDNA library of Wintersweet flower constructed in our laboratory, the cDNA sequence of the FT gene containing the complete ORF frame was detected. The experimental material of the cDNA library was Chimekou wintersweet planted in the school, and its flowers of different periods were used as materials to construct. Design specific primers according to the obtained cDNA sequence. The upstream and downstream primers contain the complete ORF sequence. The primer sequences are as follows:

[0032] CpFT-F CGTAGTCATCCAAGTATCTCAATC

[0033] CpFT-R TGGAACTGCTGTTGGACCTAT

[0034] The wax plum cDNA was used as a template, and the above-mentioned primers were used for PCR amplification, and a fragment of about 580 bp was amplified.

[0035]Recover the target fragment, connect it to T vector, construct the cloning vector, transform Escherichia coli compet...

Embodiment 2

[0036] Example 2 Analysis of Wintersweet CpFT Gene Expression

[0037] The roots, stems, cotyledons, young leaves, and mature leaves of Chimonanthus praecox (all collected from biennial Chimonanthus praecox seedlings, planted in the tissue culture room of the Flower Research Institute of Southwest University, under routine maintenance and management) and various flower organs Materials (all collected from adult wintersweet plants, planted on the campus of Southwest University, routine maintenance and management).

[0038] 1 Design and synthesis of real-time fluorescent quantitative PCR primers

[0039] The Actin and Tublin genes of Wintersweet were selected as the dual internal reference genes for real-time fluorescence quantification of the CpFT gene of Wintersweet. Primer Premier 5.0 software was used to design specific primers for the internal reference gene and the target gene CpFT, and then sent to Beijing Liuhe Huada Gene Technology Co., Ltd. Ltd Synthetics. All primer...

Embodiment 3

[0053] Example 3 Genetic Transformation and Functional Analysis of Wintersweet CpFT Gene in Arabidopsis

[0054] 1 Construction of CpFT gene plant overexpression vector

[0055] The CpFT gene was excised from the cloning vector, and then connected to the plant expression vector pCAMBIA2301G, and the plant overexpression vector pCAMBIA2301g-CpFT (or 35S::CpFT) of the Wintersweet CpFT gene was constructed. The vector schematic diagram is as follows Figure 4 shown.

[0056] 2 Transformation of Arabidopsis thaliana by flower bud infection

[0057] The transgenic recipient Arabidopsis thaliana (L.) Heynh was a wild Columbia type WT (Col-0), and its seeds were preserved by the Flower Research Institute of Southwest University.

[0058] 2.1 Culture of Arabidopsis

[0059] Take an appropriate amount of wild-type Arabidopsis WT seeds in a 1.5mL centrifuge tube, add a 17% sodium hypochlorite (NaClO) solution, fully oscillate and sterilize for 7 minutes, and then wash 5-6 times with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a Chimonanthus praecox CpFT gene and application thereof in florescence regulation. A gene sequence of the Chimonanthus praecox CpFT is represented as SEQ ID No.1. By the adoption of the Chimonanthus praecox CpFT gene and the application thereof in the florescence regulation, the Chimonanthus praecox CpFT gene is obtained by cloning for a first time, and the function of thegene is verified in plant Arabidopsis thaliana by a transgenic technology. The results show that the higher the expression quantity of the Chimonanthus praecox CpFT gene, the smaller the number of rosette leaves in transgenic Arabidopsis thaliana, and the shorter the time of sprouting, the flowering time of a first flower and the forming time of a first pod. As the time of plant transformation from vegetative growth to reproductive growth is advanced, the vegetative growth time is shortened, the number of the rosette leaves is reduced, and the flowering time is advanced. The results show thatthe Chimonanthus praecox CpFT gene can promote the flowering of plants and inhibit the vegetative growth of the plants at the same time, and the gene plays an important role in a process of floral bulging and flowering caused by breaking dormancy of flower buds of the Chimonanthus praecox at low temperature.

Description

technical field [0001] The present invention relates to the field of genetic engineering, in particular to the cloning of CpFT gene of Wintersweet and its application. Background technique [0002] Wintersweet (Chimonanthus praecox (L.) Link), belongs to Chimonanthus Lindl. of Calycanthaceae (Calycanthaceae), also known as golden plum, wintersweet, yellow plum, etc., is a unique precious ornamental flower and tree in my country. Wintersweet is a bushy shrub that can reach a height of 3 to 4 meters. Deciduous, opposite leaves, semi-leathery; flowers are born in leaf axils; the outermost perianth is brown scale-shaped, and turns yellow inward; the flowering period is from December to March of the next year; the fruiting period is from August to September, belonging to aggregated achenes. Wintersweet is a rare winter flowering plant. It flowers first and then leaves. It has sweet flowers, golden color, waxy petals and strong fragrance. It has high economic and ornamental valu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N1/21A01H5/00A01H6/20
CPCC07K14/415C12N15/827
Inventor 李志能刘宁江英杰眭顺照李名扬李先源
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap