Unlock instant, AI-driven research and patent intelligence for your innovation.

VbMYB gene and encoding protein and application thereof

A gene encoding and gene technology, applied in the field of Wufan VbMYB gene and its encoded protein that positively regulates anthocyanin synthesis

Active Publication Date: 2019-08-09
POMOLOGY RES INST FUJIAN ACAD OF AGRI SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, MYB, the regulator of anthocyanin biosynthesis in Wufan fruit, has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • VbMYB gene and encoding protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] Embodiment 1 Wufan VbMYB gene cloning

[0015] A gene whose expression level is positively correlated with the accumulation of anthocyanins in the fruit of Wufan fruit was found by comparative transcriptomics, named as BYZGR . RNA extraction and cDNA synthesis were carried out using ripe black rice fruit as material. The specific primer pair VbMYB18-F1: GGCAGCTTACATGAAAATTCTCC and VbMYB18-R1: CAAACAAAGAAATGCTTGCCG were obtained by PCR amplification BYZGR . The PCR reaction system is 50 μl, and the components include: I-5TM2xHigh-Fidelity Master Mix 25 μl, upstream and downstream primers (10 μM) each 2 μl, cDNA 1 μl, H 2 O 20 μl. The PCR program was: pre-denaturation at 90°C for 3 min, 35 cycles of 98°C for 15 s, 56°C for 15 s and 72°C for 20 s, and 72°C for 5 min.

[0016] BYZGR The gene sequence is as follows:

[0017] GGCAGCTTACATGAAAATTCTCCATGTGCTTATTAAGTTGCATGATTCAATTAAAGGGTGCTACCGTGCTACGTTGGTACATGATTAGGAAAATGGACAGAGTTCCATTAGGAGTGAGAAAGGGTACTTGGACTAAGGAAGAAGA...

Embodiment 2

[0020] Example 2 contains BYZGR Preparation of gene recombinant plasmids and recombinant genetically engineered bacteria

[0021] Use specific primer pairs: ACGGGGGACTCTTGAC ATGTGCTTATTAAGTTGCATGATTC (the underlined part is the NcoI restriction site) and ATTCGAGCTGGTCACC TTACAGTACTGCTTGTTCATCACC (the underlined part is the BstEII restriction site), the PCR reaction was carried out with the product obtained in Example 1 as a template, the PCR reaction system was 50 μl, and the components included: 25 μl of I-5TM2xHigh-Fidelity Master Mix, upstream and downstream primers ( 10μM) each 2μl, template DNA 1μl, H 2 O 20 μl. The PCR program was: pre-denaturation at 90°C for 3 min, 35 cycles of 98°C for 15 s, 56°C for 15 s and 72°C for 20 s, and 72°C for 5 min. . After recovering the obtained PCR product, use the Aidlab One Step Seamless Cloning kit to connect the target fragment into the pCAMBIA1302 vector digested with NcoI and BstEII, and perform sequencing verification to ob...

Embodiment 3

[0022] Example 3 Gene function verification

[0023] Select Tobacco Leaf Validation BYZGR gene function.

[0024] 1. Experimental method: use injection buffer (containing 10mM MES, 10mMgCl 2 , 100 μM acetosyringone) to resuspend GV3101-VbMYB, GV3101-PsMYB10.1 (application number 201811595512.1) and GV3101-PsbHLH (application number 201811595512.1) to OD 600 0.7, and stand at room temperature for 4h.

[0025] GV3101-VbMYB and GV3101-PsMYB10.1 were mixed with GV3101-PsbHLH bacteria solution in equal volumes. Then, select common tobacco with good growth, and use needleless syringe to inject GV3101-VbMYB, GV3101-PsbHLH, GV3101-PsMYB10. On both sides of the leaves, tobacco was cultured for 13 days under the conditions of 14h:10h light-dark cycle, 24°C and 70% air humidity.

[0026] 2. Experimental results:

[0027] Analysis results such as figure 1It was shown that the tobacco leaves injected with GV3101-VbMYB, GV3101-PsMYB10.1+GV3101-PsbHLH or GV3101-VbMYB+GV3101-PsbHLH Ag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant molecular biology, and particularly relates to a vaccinium bracteatum thunb myb transcription factor VbMYB gene and an encoding protein and application thereof. The invention provides a vaccinium bracteatum thunb myb transcription factor VbMYB. The nucleotide sequence of the VbMYB is shown as SEQ ID NO.1 in a sequence table. The expression of the vaccinium bracteatum thunb myb transcription factor VbMYB gene and the accumulation of anthocyanin in vaccinium bracteatum thunb peel are positively correlated, and tobacco leaves can be strongly induced toaccumulate anthocyanin. It shows that the VbMYB can be used for effectively inducing plant anthocyanin biosynthesis and is an anthocyanin synthesis positive regulation factor. The vaccinium bracteatumthunb myb transcription factor VbMYB has a transcriptional regulation effect on anthocyanin biosynthesis, can be applied to gene engineering and breeding of plant anthocyanin biosynthesis, and changes the color of tissue such as plant fruits.

Description

technical field [0001] The invention belongs to the field of plant molecular biology, and in particular relates to black rice that positively regulates the synthesis of anthocyanins BYZGR Genes and their encoded proteins and applications. Background technique [0002] black rice ( Vaccinium bracteatum Thunb.) is a perennial evergreen shrub of Rhododendronaceae, which is widely distributed in hilly areas or hillside forests or bushes at an altitude of 400-1400m in southern my country. Its fruits, roots and leaves have high medicinal value. A wild fruit tree with great development and utilization prospects. The fruit of the black rice tree is rich in various nutrients, and has anti-aging, anti-oxidation, anti-cancer and anti-cancer, antibacterial and anti-viral functions. Our study found that Wufan fruit has a strong ability to synthesize and accumulate anthocyanins (per 100g mature Wufan fruit contains more than 500 mg anthocyanins). [0003] Anthocyanin synthesis is mai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/84C12N1/21A01H5/00A01H6/82
CPCC07K14/415C12N15/825
Inventor 张雅玲方智振
Owner POMOLOGY RES INST FUJIAN ACAD OF AGRI SCI