VbMYB gene and encoding protein and application thereof
A gene encoding and gene technology, applied in the field of Wufan VbMYB gene and its encoded protein that positively regulates anthocyanin synthesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0014] Embodiment 1 Wufan VbMYB gene cloning
[0015] A gene whose expression level is positively correlated with the accumulation of anthocyanins in the fruit of Wufan fruit was found by comparative transcriptomics, named as BYZGR . RNA extraction and cDNA synthesis were carried out using ripe black rice fruit as material. The specific primer pair VbMYB18-F1: GGCAGCTTACATGAAAATTCTCC and VbMYB18-R1: CAAACAAAGAAATGCTTGCCG were obtained by PCR amplification BYZGR . The PCR reaction system is 50 μl, and the components include: I-5TM2xHigh-Fidelity Master Mix 25 μl, upstream and downstream primers (10 μM) each 2 μl, cDNA 1 μl, H 2 O 20 μl. The PCR program was: pre-denaturation at 90°C for 3 min, 35 cycles of 98°C for 15 s, 56°C for 15 s and 72°C for 20 s, and 72°C for 5 min.
[0016] BYZGR The gene sequence is as follows:
[0017] GGCAGCTTACATGAAAATTCTCCATGTGCTTATTAAGTTGCATGATTCAATTAAAGGGTGCTACCGTGCTACGTTGGTACATGATTAGGAAAATGGACAGAGTTCCATTAGGAGTGAGAAAGGGTACTTGGACTAAGGAAGAAGA...
Embodiment 2
[0020] Example 2 contains BYZGR Preparation of gene recombinant plasmids and recombinant genetically engineered bacteria
[0021] Use specific primer pairs: ACGGGGGACTCTTGAC ATGTGCTTATTAAGTTGCATGATTC (the underlined part is the NcoI restriction site) and ATTCGAGCTGGTCACC TTACAGTACTGCTTGTTCATCACC (the underlined part is the BstEII restriction site), the PCR reaction was carried out with the product obtained in Example 1 as a template, the PCR reaction system was 50 μl, and the components included: 25 μl of I-5TM2xHigh-Fidelity Master Mix, upstream and downstream primers ( 10μM) each 2μl, template DNA 1μl, H 2 O 20 μl. The PCR program was: pre-denaturation at 90°C for 3 min, 35 cycles of 98°C for 15 s, 56°C for 15 s and 72°C for 20 s, and 72°C for 5 min. . After recovering the obtained PCR product, use the Aidlab One Step Seamless Cloning kit to connect the target fragment into the pCAMBIA1302 vector digested with NcoI and BstEII, and perform sequencing verification to ob...
Embodiment 3
[0022] Example 3 Gene function verification
[0023] Select Tobacco Leaf Validation BYZGR gene function.
[0024] 1. Experimental method: use injection buffer (containing 10mM MES, 10mMgCl 2 , 100 μM acetosyringone) to resuspend GV3101-VbMYB, GV3101-PsMYB10.1 (application number 201811595512.1) and GV3101-PsbHLH (application number 201811595512.1) to OD 600 0.7, and stand at room temperature for 4h.
[0025] GV3101-VbMYB and GV3101-PsMYB10.1 were mixed with GV3101-PsbHLH bacteria solution in equal volumes. Then, select common tobacco with good growth, and use needleless syringe to inject GV3101-VbMYB, GV3101-PsbHLH, GV3101-PsMYB10. On both sides of the leaves, tobacco was cultured for 13 days under the conditions of 14h:10h light-dark cycle, 24°C and 70% air humidity.
[0026] 2. Experimental results:
[0027] Analysis results such as figure 1It was shown that the tobacco leaves injected with GV3101-VbMYB, GV3101-PsMYB10.1+GV3101-PsbHLH or GV3101-VbMYB+GV3101-PsbHLH Ag...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com