Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A highly pathogenic h7n9 avian influenza virus antigen with low receptor binding activity and preparation method thereof

An avian influenza virus, highly pathogenic technology, applied in the field of virus genetic engineering, can solve the problems of receptor affinity results, low receptor binding activity, etc., to improve accuracy, improve biological safety, and reduce HA protein receptors The effect of binding affinity

Inactive Publication Date: 2021-11-12
GUANGZHOU MEDICAL UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The second object of the present invention is to provide a HPAI H7N9 influenza virus antigen with low receptor binding activity, so as to solve the problem of the influence of the change of receptor affinity on the result in the HI test

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A highly pathogenic h7n9 avian influenza virus antigen with low receptor binding activity and preparation method thereof
  • A highly pathogenic h7n9 avian influenza virus antigen with low receptor binding activity and preparation method thereof
  • A highly pathogenic h7n9 avian influenza virus antigen with low receptor binding activity and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Methods for reducing HPAI H7N9 influenza virus receptor binding affinity

[0037] The first step is to synthesize the HA gene: First, according to the HA gene sequence of the HPAI H7N9 influenza vaccine strain A / Guangdong / 17SF003 / 2016 (H7N9) recommended by WHO, synthesize the HA gene with multiple basic amino acids deleted at the cleavage site, and the cleavage site The HA gene with multiple basic amino acids deleted (named H7 / GD16 / WT) was completed by GenScript. Existing studies have shown that the cleavage site with multiple basic amino acids is a sign of highly pathogenic avian influenza virus, and deletion of multiple basic amino acids can reduce its pathogenicity, so that the recombinant virus can be used in the biosafety secondary experiment. The procedure is performed in the chamber without affecting the immunogenicity of the HA protein. For safety reasons, the cleavage site in the HA gene of the HPAI H7N9 influenza vaccine strain with the characteristics of hig...

Embodiment 2

[0052] The difference between Example 2 and Example 1 lies in the site-directed mutation of the HA gene and the process of viral recombination: in Example 2, the arginine (R) at position 229 of the HA protein was first mutated to isoleucine (I), and then Then the arginine (R) at position 220 of the HA protein was mutated to glycine (G);

[0053] First, the arginine (R) at position 229 of the receptor binding region (encoded according to the H3 sub-HA sequence, corresponding to the 238 position of the H7 coding sequence) was mutated to isoleucine (I) to prepare the recombinant plasmid pM- H7 / GD16 / R229I; then site-directed mutagenesis was performed on the recombinant plasmid pM-H7 / GD16 / R229I, and the arginine (R) at the 220 site of the HA protein was mutated to glycine (G). The site-directed mutagenesis primers:

[0054] R220G-F: CGAGTCCAGGAGCAGGACCACAAGTTAATG, corresponding to SEQ ID NO. 6 in the sequence listing;

[0055] R220G-R: CATTAACTTGTGGGTCCTGCTCCTGGACTCG, correspondin...

Embodiment 3

[0061] The difference between Example 3 and Example 1 is that the NA fragment in Example 3 is selected from the N9NA gene with non-oseltamivir resistance mutation. The NA gene containing the oseltamivir resistance mutation has the effect of oseltamivir resistance, and the HPAI H7N9 influenza virus prepared using this mutated NA gene has the risk of drug resistance gene flooding, by using non-oseltamivir Drug-resistant mutated NA genes can avoid widespread influenza virus dissemination with oseltamivir-resistant mutated NA genes. In Example 3, the synthesis of the HA gene of H7 / GD16 / WT, the construction of the pM-H7 / GD16 / WT recombinant plasmid, the site-directed mutation of the HA gene, and the virus rescue process were the same as those in the above-mentioned Example 1.

[0062] The first step is to select the NA gene of LPAI H7N9 vaccine strain A / Anhui / 1 / 2013 (H7N9) (GISAIDID:EPI439509, called N9 / AH13), N9 / AH13 is completed by GenScript, N9 / AH13 The sequence is shown in SEQ ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a highly pathogenic H7N9 avian influenza virus antigen with low receptor binding activity and a preparation method thereof, comprising the following steps: preparing a mutant HA gene; preparing the full-length highly pathogenic H7N9 avian influenza virus after mutation The gene sequence of the HA protein is to obtain the R229I mutant HA gene; wherein the R229I mutant HA gene sequence is shown in SEQ ID NO.2; virus rescue: the R229I mutant HA gene is used to rescue the recombinant influenza virus. In the recombinant highly pathogenic H7N9 avian influenza virus prepared by the method, the arginine at position 229 in the receptor binding region is mutated into isoleucine to reduce the receptor binding affinity of the HA protein.

Description

technical field [0001] The invention relates to the field of virus genetic engineering, in particular to a highly pathogenic H7N9 avian influenza virus antigen with low receptor binding activity and a preparation method thereof. Background technique [0002] A (A) influenza virus (influenza A virus), is a representative species of Orthomyxoviridae (Orthomyxoviridae). According to the target of influenza virus infection, the virus can be divided into human influenza virus, swine influenza virus, equine influenza virus and avian influenza virus and other groups. According to the difference of hemagglutinin protein (HA protein) and neuraminidase (NA), influenza A virus can be further divided into different HA subtypes (H1-H18) and NA subtypes (N1-N11). When humans or animals are infected with the virus, it can cause influenza pandemics and even death in severe cases. [0003] In March 2013, a new H7N9 subtype influenza virus that first appeared in the world caused an epidemic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/44C07K14/11C12N15/85C12N15/66
CPCC07K14/005C12N15/66C12N15/85C12N2760/16022
Inventor 王洋陈凌潘蔚绮吕云华董记
Owner GUANGZHOU MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com