Application of corn BBM1 gene for improving plant genetic transformation efficiency
A technology of genetic transformation efficiency, corn, applied in the application, plant products, genetic engineering and other directions, can solve the problems of low transformation efficiency and genotype limitation, and achieve the effect of improving transformation efficiency, broadening species, and providing genetic resources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Cloning of Example 1 Maize ZmBBM1 Gene
[0029] According to MaizeGDB (https: / / www.maizegdb.org / ), the gene expression pattern of maize ZmBBM1 was predicted, and the shoot apical meristem (SAM), root, 16-20 days after pollination and endosperm of V3 and V5 were extracted respectively RNA was reverse-transcribed into cDNA, and cDNA and genomic DNA were used as templates to amplify the ZmBBM1 gene ( figure 1 ), the full length of the CDS region of the gene is 2040bp. The amplification system is as follows:
[0030]
[0031] The primer sequences are as follows (5'-3'):
[0032] BM-F: AGAACACGGGGGACTCTTGACCATGGCTTCAGCGAACAACTGGCTG
[0033] BM-R: CGATCGGGGAAATTCGAGCTGGTCACCTCACCCCATGCCGTTGTTGAAAG
[0034] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 15 s, annealing at 60°C for 30 s, extension at 68°C for 2 min and 30 s, 28 cycles; extension at 68°C for 10 min, and incubation at 16°C.
[0035] The resulting PCR ...
Embodiment 2
[0036] Example 2 Construction of p3301-35S-ZmBBM1 vector
[0037] The target BBM1 fragment prepared in Example 1 and the pCAMBIA3301 plant expression vector were digested with NcoI and BstEII, and the PCR product purification kit (purchased from Tiangen Biochemical Technology Co., Ltd.) was used to recover the fragments according to the instructions. The two fragments were connected with Infusion enzyme to construct recombinant plasmid p3301-35S-ZmBBM1 ( figure 2 ).
[0038] Connection system:
[0039]
[0040] The ligation reaction was carried out at 50°C for 15 minutes.
Embodiment 3
[0041] Embodiment 3 recombinant plasmid is transformed into Agrobacterium LBA4404
[0042] The steps for transferring the recombinant plasmid p3301-35S-ZmBBM1 into Agrobacterium LBA4404 are as follows:
[0043] (1) Take 5 μL of the plasmid and add it to 200 μL of Agrobacterium competent cells;
[0044] (2) Ice bath for 30 minutes;
[0045] (3) Take it out from the ice, and quickly place it in liquid nitrogen for quick freezing for 5 minutes;
[0046] (4) Take it out from the liquid nitrogen and incubate in a water bath at 37°C for 5 minutes;
[0047] (5) Take it out and put it on ice for 5 minutes;
[0048] (6) Add 800 μL of blank YEB medium, and recover on a shaker at 28°C at 200 rpm for 4-5 hours;
[0049] (7) 4000rpm normal temperature centrifugation for 5min;
[0050] (8) Discard part of the supernatant, and suspend the precipitate with the remaining about 200 μL supernatant, spread it on a YEB solid culture plate containing the corresponding resistance, and incubate ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap