Application of corn BBM1 gene for improving plant genetic transformation efficiency

A technology of genetic transformation efficiency, corn, applied in the application, plant products, genetic engineering and other directions, can solve the problems of low transformation efficiency and genotype limitation, and achieve the effect of improving transformation efficiency, broadening species, and providing genetic resources

Active Publication Date: 2019-08-09
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, maize genetic transformation technology is becoming more and more mature, but there are still problems such as severe genotype restrictions and low transformation efficiency, which cannot meet the needs of gene function research and new material creation. It is urgent to establish a set of efficient, stable and applicable genotypes. Maize Transformation System

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of corn BBM1 gene for improving plant genetic transformation efficiency
  • Application of corn BBM1 gene for improving plant genetic transformation efficiency
  • Application of corn BBM1 gene for improving plant genetic transformation efficiency

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Cloning of Example 1 Maize ZmBBM1 Gene

[0029] According to MaizeGDB (https: / / www.maizegdb.org / ), the gene expression pattern of maize ZmBBM1 was predicted, and the shoot apical meristem (SAM), root, 16-20 days after pollination and endosperm of V3 and V5 were extracted respectively RNA was reverse-transcribed into cDNA, and cDNA and genomic DNA were used as templates to amplify the ZmBBM1 gene ( figure 1 ), the full length of the CDS region of the gene is 2040bp. The amplification system is as follows:

[0030]

[0031] The primer sequences are as follows (5'-3'):

[0032] BM-F: AGAACACGGGGGACTCTTGACCATGGCTTCAGCGAACAACTGGCTG

[0033] BM-R: CGATCGGGGAAATTCGAGCTGGTCACCTCACCCCATGCCGTTGTTGAAAG

[0034] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 15 s, annealing at 60°C for 30 s, extension at 68°C for 2 min and 30 s, 28 cycles; extension at 68°C for 10 min, and incubation at 16°C.

[0035] The resulting PCR ...

Embodiment 2

[0036] Example 2 Construction of p3301-35S-ZmBBM1 vector

[0037] The target BBM1 fragment prepared in Example 1 and the pCAMBIA3301 plant expression vector were digested with NcoI and BstEII, and the PCR product purification kit (purchased from Tiangen Biochemical Technology Co., Ltd.) was used to recover the fragments according to the instructions. The two fragments were connected with Infusion enzyme to construct recombinant plasmid p3301-35S-ZmBBM1 ( figure 2 ).

[0038] Connection system:

[0039]

[0040] The ligation reaction was carried out at 50°C for 15 minutes.

Embodiment 3

[0041] Embodiment 3 recombinant plasmid is transformed into Agrobacterium LBA4404

[0042] The steps for transferring the recombinant plasmid p3301-35S-ZmBBM1 into Agrobacterium LBA4404 are as follows:

[0043] (1) Take 5 μL of the plasmid and add it to 200 μL of Agrobacterium competent cells;

[0044] (2) Ice bath for 30 minutes;

[0045] (3) Take it out from the ice, and quickly place it in liquid nitrogen for quick freezing for 5 minutes;

[0046] (4) Take it out from the liquid nitrogen and incubate in a water bath at 37°C for 5 minutes;

[0047] (5) Take it out and put it on ice for 5 minutes;

[0048] (6) Add 800 μL of blank YEB medium, and recover on a shaker at 28°C at 200 rpm for 4-5 hours;

[0049] (7) 4000rpm normal temperature centrifugation for 5min;

[0050] (8) Discard part of the supernatant, and suspend the precipitate with the remaining about 200 μL supernatant, spread it on a YEB solid culture plate containing the corresponding resistance, and incubate ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides application of a corn BBM1 gene for improving the plant genetic transformation efficiency. For the first time, the corn BBM1 gene can promote the genetic transformation efficiency of plants such as corn, and precious gene resources are provided for genetic breeding. The gene can improve the genetic transformation efficiency of the transformed corn variety syndrome-31 and thelike, the corn variety B73 and other transformation efficiency is improved, the corn transformation gene limit can be effectively solved, and the corn transformation acceptor varieties are enlarged.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of maize BBM1 gene in improving the efficiency of plant genetic transformation. Background technique [0002] Maize is one of the three major food crops in the world and plays an important role in world food production. Genetically modified crops are one of the directions of future agricultural development. Genetically modified corn has great development prospects in improving corn quality, increasing corn yield, improving corn stress resistance, reducing pesticide and fertilizer use and pesticide residues, so we are committed to the research of genetically modified corn It is of great significance, and the cultivation of transgenic maize requires efficient maize genetic transformation methods. At present, maize genetic transformation technology is becoming more and more mature, but there are still problems such as severe genotype restrictions and low transformation ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/46
CPCC12N15/8205C12N15/8216
Inventor 刘允军刘艳王国英
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap