Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of Maize bbm1 Gene in Improving Plant Genetic Transformation Efficiency

A technology of genetic transformation efficiency and corn, applied in the application, plant products, genetic engineering and other directions, can solve the problems of low transformation efficiency and genotype limitation, and achieve the effect of improving transformation efficiency, broadening species, and solving genotype limitations of corn transformation.

Active Publication Date: 2021-02-02
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, maize genetic transformation technology is becoming more and more mature, but there are still problems such as severe genotype restrictions and low transformation efficiency, which cannot meet the needs of gene function research and new material creation. It is urgent to establish a set of efficient, stable and applicable genotypes. Maize Transformation System

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Maize bbm1 Gene in Improving Plant Genetic Transformation Efficiency
  • Application of Maize bbm1 Gene in Improving Plant Genetic Transformation Efficiency
  • Application of Maize bbm1 Gene in Improving Plant Genetic Transformation Efficiency

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028]Example 1 Cloning of maize ZmBBM1 gene

[0029]According to MaizeGDB (https: / / www.maizegdb.org / ) to predict the gene expression pattern of maize ZmBBM1, extract the shoot apical meristem (SAM), root, 16-20 days post-pollination embryo and endosperm of V3 and V5 respectively RNA, reverse transcribed into cDNA, using cDNA and genomic DNA as templates to amplify the ZmBBM1 gene (figure 1 ), the CDS region of the gene is 2040bp in length. The amplification system is as follows:

[0030]

[0031]The primer sequence is as follows (5′-3′):

[0032]BM-F:AGAACACGGGGGACTCTTGACCATGGCTTCAGCGAACAACTGGCTG

[0033]BM-R: CGATCGGGGAAATTCGAGCTGGTCACCTCACCCCATGCCGTTGTTGAAAG

[0034]The PCR reaction procedure is as follows: 95°C pre-denaturation for 5 minutes; 98°C denaturation for 15s, 60°C annealing for 30s, 68°C extension for 2min30s, 28 cycles; 68°C extension for 10 minutes, 16°C incubation.

[0035]The resulting PCR products were electrophoresed on a 1.5% agarose gel, and the gel was cut to recover the target fr...

Embodiment 2

[0036]Example 2 Construction of p3301-35S-ZmBBM1 vector

[0037]The target BBM1 fragment and pCAMBIA3301 plant expression vector prepared in Example 1 were digested with NcoI and BstEII, and the fragments were recovered using PCR product purification kit (purchased from Tiangen Biochemical Technology Co., Ltd.) according to the instructions. The two fragments were ligated with Infusion enzyme to construct a recombinant plasmid p3301-35S-ZmBBM1(figure 2 ).

[0038]Connection system:

[0039]

[0040]The ligation reaction was carried out at 50°C for 15 minutes.

Embodiment 3

[0041]Example 3 Transformation of recombinant plasmid into Agrobacterium LBA4404

[0042]The steps to transform the recombinant plasmid p3301-35S-ZmBBM1 into Agrobacterium LBA4404 are as follows:

[0043](1) Take 5μL of plasmid and add it to 200μL of Agrobacterium competent cells;

[0044](2) Ice bath for 30 minutes;

[0045](3) Take it out of ice and quickly place it in liquid nitrogen for quick freezing for 5 minutes;

[0046](4) Take it out of liquid nitrogen and incubate in a 37°C water bath for 5 minutes;

[0047](5) Put it on ice for 5 minutes after taking it out;

[0048](6) Add 800μL of blank YEB medium, and restore for 4-5h on a shaker at 28°C at 200rpm;

[0049](7) Centrifuge at 4000rpm for 5min at room temperature;

[0050](8) Discard a portion of the supernatant, and suspend the precipitate with about 200 μL of the supernatant, spread it on a YEB solid culture plate containing the corresponding resistance, and invert it in the dark at 28°C for 36 hours;

[0051](9) Pick a single colony grown on the p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the application of the corn BBM1 gene in improving the efficiency of plant genetic transformation. The invention discovers for the first time that the maize BBM1 gene can promote the genetic transformation efficiency of plants (such as maize) and provide valuable gene resources for genetic breeding. The gene not only improves the genetic transformation efficiency of easy-to-transform maize varieties Zong 31, etc., but also improves the transformation efficiency of maize varieties such as B73, which can effectively solve the genotype limitation of maize transformation and broaden the types of recipient varieties for maize transformation.

Description

Technical field[0001]The invention relates to the field of biotechnology, in particular to the application of maize BBM1 gene in improving plant genetic transformation efficiency.Background technique[0002]Corn is one of the three major food crops in the world, and it occupies an important position in world food production. Genetically modified crops are one of the future directions of agricultural development. Genetically modified maize has great development prospects in improving maize quality, increasing maize yield, improving maize stress resistance, reducing the use of pesticides and fertilizers and pesticide residues. Therefore, we are committed to research on genetically modified maize. It is of great significance, and the cultivation of transgenic maize requires efficient maize genetic transformation methods. At present, maize genetic transformation technology is becoming more and more mature, but there are still problems such as severe genotype restriction and low transforma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/46
CPCC12N15/8205C12N15/8216
Inventor 刘允军刘艳王国英
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com