Novel target for preventing and treating hepatitis C and CRISPR-Cas9 targeting system and application thereof

A viral hepatitis and target technology, applied in the field of biomedicine, can solve the problems of high reinfection rate of hepatitis C patients, drug side effects, high cost, etc., to reduce the defects of incomplete silencing or inability to silence gene expression, high efficiency and specificity Effects of knockout and improved targeting

Active Publication Date: 2019-08-13
广州艾迪基因科技有限责任公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this treatment plan will also produce drug side effects, and the treatment process is accompanied by drug resistance mutations and high costs.
In addition, there is no preventive drug or treatment for HCV before the virus invades, and the reinfection rate of patients with advanced hepatitis C after liver transplantation is very high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel target for preventing and treating hepatitis C and CRISPR-Cas9 targeting system and application thereof
  • Novel target for preventing and treating hepatitis C and CRISPR-Cas9 targeting system and application thereof
  • Novel target for preventing and treating hepatitis C and CRISPR-Cas9 targeting system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 sgRNA design

[0035] Design and synthesis of sgRNA sequence:

[0036] sgRNA was designed for the miR-615-3p gene precursor sequence, and a total of 8 sgRNAs were designed:

[0037] (1) ctcgggaggggcgggaggg

[0038] (2) aggggcgggaggggggtccc

[0039] (3) ggaagaggggagaccccaggct

[0040] (4) ccccggtgctcggatctcga

[0041] (5) tctcgagggtgcttattgtt

[0042] (6) ttattgttcggtccgagcct

[0043] (7) tgggggggaagaggggagaccc

[0044] (8) ggaagaggggagaccccaggct

[0045] After optimized screening, item (8) was selected.

Embodiment 2

[0046] Example 2 Constructing the sgRNA expression vector of miR-615-3p gene

[0047] 1. Preparation of sgRNA sequence DNA fragments

[0048] (1) Synthesize the forward and reverse phosphorylated oligonucleotide sequences of the above-mentioned embodiment 1 (8) sgRNA:

[0049] F(5'-3') (SEQ ID NO.3): CACCG ggaagaggggagaccccaggct

[0050] R(5'-3') (SEQ ID NO.4): AAACagcctgggtctccctcttccC

[0051] The corresponding forward and reverse oligonucleotide sequences are annealed and annealed to form double-stranded DNA fragments with cohesive ends.

[0052] The reaction (10 μL) system is as follows:

[0053]

[0054] (2) Put the above reaction system into the PCR machine, and carry out the reaction according to the following procedure.

[0055] Reaction procedure:

[0056] 95℃ 5min

[0057] 95-25℃ 5℃ / min

[0058] The reaction product was stored at -20°C.

[0059] 2. Construction of sgRNA expression vector

[0060] (1) Digest the target vector lentiCRISPR-v2 plasmid with BsmB...

Embodiment 3

[0070] Example 3 Construction of Huh.7.5 Stable Cell Line by Lentiviral System

[0071] 1. Virus packaging

[0072] By culturing 293FT cells, transfect according to the ratio of core plasmid: packaging plasmid: envelope plasmid = 4:3:2, the core plasmid of the sgRNA group is: lentiCRISPR-v2-sgRNA-miR-615-3p, with lentiCRISPR-v2 as control group. The virus liquid was collected at 24h, 48h and 72h after transfection, and the three virus liquids collected from the cells were mixed and concentrated by ultrafiltration and the virus titer was determined.

[0073] 2. Cell transfection

[0074] The Huh.7.5 cells were plated one day in advance, and the cell density reached 40-60% at the time of transfection. The culture medium was removed before transfection, the virus concentrate and transfection reagent were diluted with fresh medium to treat the cells, and 1.0 μg / mL puromycin was used for selection after 96 hours of infection, and the selection time was 7 days. After selection b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel target for preventing and treating viral hepatitis C and a CRISPR-Cas9 targeting system and application thereof. The invention discloses a novel target for preventing and treating viral hepatitis C, namely miR-615-3p. The gene has a positive regulation relationship with ApoB and ApoE, the expression of ApoB and ApoE genes can be inhibited after the miR-615-3p is knocked out, and accordingly viral hepatitis C are prevented and treated. In addition, the CRISPR-Cas9 targeting system of the specific target miR-615-3p is constructed. The Cas9 system can be used for efficiently and specifically knocking out the miR-615-3p gene, the targeting property is improved, an operation technology is simple, the novel target has a good application prospect on the aspect of prevention and treatment of the viral hepatitis C. Furthermore, the achievement of the invention is helpful for further revealing the molecular mechanism of prevention and treatment of the viral hepatitis C, and the novel target has very important significance in research and development of new treatment schemes.

Description

technical field [0001] The invention belongs to the technical field of biomedicine. More specifically, it relates to a new target for the prevention and treatment of viral hepatitis C and its CRISPR-Cas9 targeting system and application. Background technique [0002] Viral hepatitis C is a viral hepatitis caused by hepatitis C virus (HCV) infection, which can be transmitted through mother to child, blood transfusion, and sexual contact. About 180 million people in the world are infected with HCV, leading to liver fibrosis and cirrhosis, and even liver cancer in severe cases, which has become one of the most important public health problems in the world. [0003] The early treatment of HCV is mainly through pegylated interferon combined with ribavirin, but the side effects are relatively large, the treatment cycle is long, and the curative effect is different for different genotypes. In recent years, direct antiviral agents (Direct antiviral agents, DAA) have made great pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K48/00A61P1/16A61P31/14C12N15/90C12N15/867C12N15/113C12N5/10
CPCA61K48/005A61P1/16A61P31/14C12N15/907C12N15/86C12N15/113C12N5/0693C12N2800/107C12N2740/15043C12N2810/10C12N2310/141Y02A50/30
Inventor张旭王宏盖作启
Owner广州艾迪基因科技有限责任公司