Construction and application of free non-methanol induced pichia pastoris expression vector

A Pichia pastoris and expression vector technology, applied in the field of genetic engineering, can solve the problems of long production time, bacterial toxicity, unsuitable food, etc., and achieve the effects of improved capacity, wide sources and low production costs

Inactive Publication Date: 2019-08-30
JIANGNAN UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The promoter commonly used in inducible expression systems is the methanol metabolism promoter P AOX1 , the expression system induced by methanol also has some disadvantages compared with the constitutive expression system
First, the production time is long. The inducer used in the Pichia pastoris system is methanol, and the utilization rate and assimilation efficiency of Pichia pastoris to methanol are low, and the biomass of the bacteria grows very slowly during the induction stage. Excessive methanol Accumulation may even cause certain toxicity to the bacteria. Correspondingly, the accumulation rate of the target protein during the induction stage is also slow, resulting in a longer production time.
Second, Pichia pastoris is an aerobic microorganism, and the metabolism of methanol also requires a large amount of oxygen, which directly causes dissolved oxygen to become a limiting factor in the production process
Third, Pichia pastoris needs a large amount of methanol as a carbon source and inducer when expressing foreign proteins. The long-term storage of a large amount of methanol brings safety hazards. In addition, methanol is also a highly toxic substance and is not suitable for food applications. , thus constraining P AOX1 Large-scale application of expression vectors in the food field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of free non-methanol induced pichia pastoris expression vector
  • Construction and application of free non-methanol induced pichia pastoris expression vector
  • Construction and application of free non-methanol induced pichia pastoris expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of free-type non-methanol-induced Pichia pastoris expression vector pGCW14ZαA-PARS2

[0045] By colony PCR, using a single colony of wild Pichia pastoris KM71 as a template, design a forward primer with the sequence shown in SEQ ID NO.3: GTCATGCATGAGATCCAGGTGAACCCACCTAACT, and a reverse primer with the sequence shown in SEQ ID NO.4: TTCTCATCGTTTCGAATTTGTTGTTTGAGTGAAGCG. Obtaining the promoter P by polymerase chain reaction GCW14 Sequence fragments. Promoter P GCW14 Sequence fragment, P in the pGAPZαA vector by infusion enzyme GAP Promoter replaced with promoter P GCW14 , construct the expression vector pGCW14ZαA.

[0046] The self-replicating sequence PARS2 with nucleotide sequence as shown in SEQ ID NO.2 was synthesized by whole gene synthesis technology; the recovered PARS2 sequence fragment was connected with plasmid pGCW14ZαA by infusion enzyme to construct expression vector pGCW14ZαA-PARS2.

Embodiment 2

[0047] Example 2 Application of pGCW14ZαA-PARS2 in the production of xylanase

[0048] 1. Construction of free-type pGCW14ZαA-PARS2-XynA recombinant bacteria

[0049] Using the plasmid pMD18-T-XynA (see the literature for the construction method: A xylanase from Streptomycessp.FA1: heterologous expression, characterization, and its application in Chinese steamed bread, Yang Xu, Journal of Industrial Microbiology & Biotechnology, May 2016, Volume43, Issue5, pp 663– 670) as a template, design a forward primer whose sequence is shown in SEQ ID NO.5: CCGGAATTCATGGCCGAGAACACCCTT, and a reverse primer whose sequence is shown in SEQ ID NO.6: ATTTGCGGCCGCTCAGGTGCGGGTCCAGCGTT. The XynA fragment with Not I and EcoR I restriction sites was obtained by polymerase chain reaction.

[0050] PCR reaction system (50μL):

[0051]

[0052] PCR program: 94°C, 4min (pre-denaturation); 98°C, 10s (denaturation); 60°C, 5s (annealing); 72°C, 90s (extension); set 30 cycles; set after 72°C, 10min (...

Embodiment 3

[0084] Example 3: Application of pGCW14ZαA-PARS2 in the production of Aspergillus niger β-mannanase AnMan5

[0085] Synthesize the β-mannanase gene shown in SEQ ID NO.8, digest it with pGCW14ZαA-PARS2, ligate overnight at 16°C after digestion, transform E.coli JM109, and coat LB containing zecoin resistance Plate, cultured at 37°C for 8-10 hours, pick the transformant, extract the recombinant plasmid and verify it by double enzyme digestion, then determine the DNA sequence of the verified recombinant plasmid, the positive clone is pGCW14ZαA-PARS2-AnMan5.

[0086] Transformation of recombinant plasmid pGCW14ZαA-PARS2-AnMan5:

[0087] (1) Take out the electro-spinning cup from the ethanol, put it in an ultra-clean bench to dry it, and put it in ice to pre-cool it for later use

[0088] (2) Perform the following operations on ice: pre-cool the recombinant episomal plasmid pGCW14ZαA-PARS2-gan, absorb 5 μL and quickly mix it with 80 μL yeast competent medium, transfer to a 0.2 cm ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to construction of a free non-methanol induced pichia pastoris expression vector and an application of the expression vector in enzyme recombination expression, and belongs to the technical field of genetic engineering. The non-methanol induced pichia pastoris expression vector is obtained by inserting a kluyveromyces lactis autonomous replication sequence PARS2 and a pichiapastoris promoter PGCW14 sequence into a vector framework, and constructing a free vector with a self-replication sequence. Compared with the general integrated recombinant pichia pastoris engineeringbacteria, the free recombinant pichia pastoris engineering bacteria constructed by the vector have obviously-improved capability of secreting and producing recombinant enzymes. In addition, the fermentation raw materials have wide sources, and the production cost is low.

Description

technical field [0001] The invention relates to the construction and application of a free non-methanol-induced Pichia pastoris expression vector, which belongs to the technical field of genetic engineering. Background technique [0002] Pichia pastoris expression system mainly includes inducible expression system and constitutive expression system. The promoter commonly used in inducible expression systems is the methanol metabolism promoter P AOX1 , the expression system induced by methanol also has some disadvantages compared with the constitutive expression system. First, the production time is long. The inducer used in the Pichia pastoris system is methanol, and the utilization rate and assimilation efficiency of Pichia pastoris to methanol are low, and the biomass of the bacteria grows very slowly during the induction stage. Excessive methanol Accumulation may even cause certain toxicity to the bacteria. Correspondingly, the accumulation rate of the target protein du...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19C12N9/24C12R1/84
CPCC12N9/248C12N9/2494C12N15/815C12Y302/01078
Inventor吴敬胡梦凯夏伟吴丹
OwnerJIANGNAN UNIV