Unlock instant, AI-driven research and patent intelligence for your innovation.

Nilaparvata lugens eye color gene NlGCHI and its encoded protein, and application thereof

A technology of coding protein and brown planthopper, applied in application, genetic engineering, recombinant DNA technology, etc., can solve the problems of brown planthopper growth and development and lethal effect not obvious, serious environmental pollution, high toxicity, etc.

Inactive Publication Date: 2019-09-03
CHINA NAT RICE RES INST
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(2) Serious environmental pollution
(3) Highly toxic to some non-target organisms
Although eating these transgenic rice lines can reduce the transcription level of related genes to a certain extent, it has no obvious effect on the growth and death of brown planthopper (Yu Hui, 2013; Zhang Fengzhen, 2013; Yang Yongyi, 2014)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nilaparvata lugens eye color gene NlGCHI and its encoded protein, and application thereof
  • Nilaparvata lugens eye color gene NlGCHI and its encoded protein, and application thereof
  • Nilaparvata lugens eye color gene NlGCHI and its encoded protein, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Brown planthopper NlGCH gene cloning

[0032]Firstly, by bioinformatics method, the amino acid sequence of Drosophila melanogaster GCHI protein was used as the search source to search for homologous sequences in the N. lugens genome and transcriptome databases, and two highly homologous sequences were obtained (pNlGCH The consensus open reading frame (ORF) sequence of the two transcripts, clone and construct a plasmid for subsequent experiments, the recombinant plasmid contains the sequence shown in SEQ ID NO.1 or SEQ ID NO.2; or the recombinant plasmid contains SEQ ID NO.1 and The common sequence of the sequence shown in SEQ ID NO.2.

[0033] ORF sequence amplification primers are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0034] GCHI-F (SEQ ID NO. 5): ATGGAGCTGGACCACAGACCAC

[0035] GCHI-R (SEQ ID NO. 6): CAAGAATTCCTCGCGTGTCTTGG.

[0036] cloned brown planthopper NlGCH There are two different transcripts, the complete cDNA sequences of which are shown in SE...

Embodiment 2

[0037] Example 2 Brown planthopper NlGCH and its control fluorescent protein gene GFP dsRNA synthesis

[0038] 1. Containing T7 promoter NlGCH and green fluorescent protein gene GFP dsDNA synthesis

[0039] Constructed in Example 1 NlGCH Recombinant plasmids and those already contained in our laboratory GFP dsDNA was amplified and purified and recovered. The length of dsGCHI was 306bp, and the length of dsGFP was 360bp. The DNA sequence corresponding to the synthesis of dsGCHI was shown in SEQ ID NO.11.

[0040] dsRNA synthesis primers

[0041] dsGCHI-F (SEQ ID NO. 7): taatacgactcactataggggagaGCATCACTTGGTCCCATTC

[0042] dsGCHI-R (SEQ ID NO. 8): taatacgactcactatagggagaAATTCCTCGCGTGTCTTGG

[0043] dsGFP-F (SEQ ID NO. 9): taatacgactcactatagggagaATGCCACCTACGGCAAGCT

[0044] dsGFP-R (SEQ ID NO. 10): taatacgactcactatagggagaTCGGCCATGATATAGACGTT

[0045] Lowercase bases are the T7 RNA polymerase promoter sequence.

[0046] PCR amplification conditions: 95°C 2min; (98°...

Embodiment 3

[0052] Example 3 Injection of dsGCHI and dsGFP on 3rd instar nymphs and detection of their effects

[0053] 1. Collection of test insects Transfer the multi-egg-bearing females to TN1 (Taichung Native l) rice seedlings at the tillering stage to lay eggs, and remove them after 24 hours. After the nymphs hatched, the newly hatched nymphs were gently patted on new rice seedlings every 12 hours for rearing, so as to obtain test worms of the same age.

[0054] 2. Prepare agarose gel with a mass concentration of 1.5-2.0% for test insect injection, pour the melted agarose gel into a petri dish, the height of the agarose gel is slightly higher than the petri dish, and place 2- 3 capillaries with a diameter of 0.5-0.8mm. After the agarose gel is cooled, remove the capillary to obtain the grooved agarose gel. Transfer the 3rd instar mid-stage nymphs into glass test tubes with CO 2 After anesthetizing for 2 minutes, place the test worms neatly in the grooves of the agarose gel. Using...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nilaparvata lugens eye color gene NlGCHI and its encoded protein, and an application thereof, which belong to the technical field of biology. The invention discloses the nilaparvata lugens eye color gene NlGCHI, and also discloses the purpose of the nilaparvata lugens eye color gene NlGCHI. The gene and the encoded protein thereof provide a candidate gene for the futureRNAi-mediated pest control strategy of the nilaparvata lugens, and provide a new direction for the development of new insecticides; and also provide new ideas for crop breeding, especially paddy ricepest-resistant breeding based on an RNAi principle.

Description

technical field [0001] The invention belongs to the field of biological technology, in particular to the eye color gene of brown planthopper NlGCH And its encoded protein, application. Background technique [0002] Rice ( Oryza sativa ) is not only a staple food for more than half of the world's population, but also the main source of nutrition for more than 750 million people in impoverished areas (Zeigler 2009). However, rice quality and yield are vulnerable to various pests and diseases (Zeigler 2009). Brown planthopper (BPH, Nilaparvata lugens ), belonging to the family Hemiptera (Hemiptera: Delphacidae), is the primary pest of rice in my country and many Asian countries. N. lugens is a monophagous pest, which can suck phloem sap and transmit viral diseases, such as tussock dwarf disease and leaf dwarf disease (Huang and Huang, 2001; Wen et al., 2009, Xue et al ., 2014). Infestation by brown planthoppers can reduce rice panicle number, grain number and 1000-grain...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/78C12N15/113A01N57/16A01P7/04A01H5/00A01H6/46
CPCA01N57/16C12N9/78C12N15/113C12N2310/14C12Y305/04016
Inventor 刘淑华唐健杨保军王爱英
Owner CHINA NAT RICE RES INST