Brown planthopper eye color gene nlgchi and its encoded protein and application
A brown planthopper, applied technology, applied in the direction of application, genetic engineering, recombinant DNA technology, etc., can solve the problems of brown planthopper growth and development and lethal effect not obvious, serious environmental pollution, high toxicity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Brown planthopper NlGCH gene cloning
[0032]Firstly, by bioinformatics method, the amino acid sequence of Drosophila melanogaster GCHI protein was used as the search source to search for homologous sequences in the N. lugens genome and transcriptome databases, and two highly homologous sequences were obtained (pNlGCH The consensus open reading frame (ORF) sequence of the two transcripts, clone and construct a plasmid for subsequent experiments, the recombinant plasmid contains the sequence shown in SEQ ID NO.1 or SEQ ID NO.2; or the recombinant plasmid contains SEQ ID NO.1 and The common sequence of the sequence shown in SEQ ID NO.2.
[0033] ORF sequence amplification primers are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0034] GCHI-F (SEQ ID NO. 5): ATGGAGCTGGACCACAGACCAC
[0035] GCHI-R (SEQ ID NO. 6): CAAGAATTCCTCGCGTGTCTTGG.
[0036] cloned brown planthopper NlGCH There are two different transcripts, the complete cDNA sequences of which are shown in SE...
Embodiment 2
[0037] Example 2 Brown planthopper NlGCH and its control fluorescent protein gene GFP dsRNA synthesis
[0038] 1. Containing T7 promoter NlGCH and green fluorescent protein gene GFP dsDNA synthesis
[0039] Constructed in Example 1 NlGCH Recombinant plasmids and those already contained in our laboratory GFP dsDNA was amplified and purified and recovered. The length of dsGCHI was 306bp, and the length of dsGFP was 360bp. The DNA sequence corresponding to the synthesis of dsGCHI was shown in SEQ ID NO.11.
[0040] dsRNA synthesis primers
[0041] dsGCHI-F (SEQ ID NO. 7): taatacgactcactataggggagaGCATCACTTGGTCCCATTC
[0042] dsGCHI-R (SEQ ID NO. 8): taatacgactcactatagggagaAATTCCTCGCGTGTCTTGG
[0043] dsGFP-F (SEQ ID NO. 9): taatacgactcactatagggagaATGCCACCTACGGCAAGCT
[0044] dsGFP-R (SEQ ID NO. 10): taatacgactcactatagggagaTCGGCCATGATATAGACGTT
[0045] Lowercase bases are the T7 RNA polymerase promoter sequence.
[0046] PCR amplification conditions: 95°C 2min; (98°C...
Embodiment 3
[0052] Example 3 Injection of dsGCHI and dsGFP on 3rd instar nymphs and detection of their effects
[0053] 1. Collection of test insects Transfer the multi-egg-bearing females to TN1 (Taichung Native l) rice seedlings at the tillering stage to lay eggs, and remove them after 24 hours. After the nymphs hatched, the newly hatched nymphs were gently patted on new rice seedlings every 12 hours for rearing, so as to obtain test worms of the same age.
[0054] 2. Prepare agarose gel with a mass concentration of 1.5-2.0% for test insect injection, pour the melted agarose gel into a petri dish, the height of the agarose gel is slightly higher than the petri dish, and place 2- 3 capillaries with a diameter of 0.5-0.8mm. After the agarose gel is cooled, remove the capillary to obtain the grooved agarose gel. Transfer the 3rd instar mid-stage nymphs into glass test tubes with CO 2 After anesthetizing for 2 minutes, place the test worms neatly in the grooves of the agarose gel. Using...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


