Preparation method and application of non-human animals or offspring thereof genetically modified by Hr gene

A non-human animal and genetic modification technology is applied in the field of preparation and application of genetically modified non-human animals with Hr gene or their progeny, which can solve the problems of cell residues, humoral immunity leakage, impure background, etc., and save time. and cost, reduce the risk of drug development, and speed up the process of new drug development

Active Publication Date: 2019-09-03
BIOCYTOGEN JIANGSU CO LTD +1
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] US Jackson Laboratory (Jackson Laboratory) used CRISPR technology to mutate the Rhbdf2 gene of NSG (NOD SCIDIL2γg- / -) mice to obtain NSG-BSLD mice, which have a hairless phenotype (PCT / US2016 / 059711), but The NSG background mice may still have the problems of background impurity, residual T, B, NK cells, and leakage of humoral immunity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of non-human animals or offspring thereof genetically modified by Hr gene
  • Preparation method and application of non-human animals or offspring thereof genetically modified by Hr gene
  • Preparation method and application of non-human animals or offspring thereof genetically modified by Hr gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0126] Example 1 Design of Hr gene sgRNA

[0127] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0128] Multiple sgRNAs were designed for the mouse Hr gene (NCBI Gene ID: 15460), wherein the target site sequence targeted by each sgRNA is as follows:

[0129] sgRNA1 target site sequence (SEQ ID NO: 1): 5'-acccgacaggctcgagtcactgg-3'

[0130] sgRNA2 target site sequence (SEQ ID NO: 2): 5'-cctggcactgccgtcgggcttgg-3'

[0131] sgRNA3 target site sequence (SEQ ID NO: 3): 5'-ccccagagagacgcaagcgaggg-3'

[0132] sgRNA4 target site sequence (SEQ ID NO: 4): 5'-cgctgctaactgaagcccggagg-3'

[0133] sgRNA5 target site sequence (SEQ ID NO: 5): 5'-ttccctcgcttgcgtctctctgg-3'

[0134] sgRNA6 target site sequence (SEQ ID NO: 6): 5'-ggtgccctggcactgccgtcggg-3'

[0135] sgRN...

Embodiment 2

[0144] Example 2 Screening of sgRNA

[0145] UCA kit was used to detect the activity of the above sgRNA, and the results showed that the sgRNA had different activities. For the test results, see figure 1 and Table 1. According to the results of the activity test, sgRNA4 and sgRNA10 are preferred and TAGG is added to the 5' end of its upstream sequence to obtain sgRNA4 and sgRNA10 forward oligonucleotides respectively, and AAAC is added to the 5' end of its complementary strand (downstream sequence) respectively sgRNA4 and sgRNA10 were obtained to obtain reverse oligonucleotides, and subsequent experiments were performed after synthesizing forward and reverse oligonucleotides.

[0146] Upstream of sgRNA4 sequence: 5'-cgctgctaactgaagcccgg-3' (SEQ ID NO: 15)

[0147] sgRNA4 forward oligonucleotide: 5'-taggcgctgctaactgaagcccgg-3' (SEQ ID NO: 16)

[0148] Downstream of sgRNA4 sequence: 5'-ccgggcttcagttagcagcg-3' (SEQ ID NO: 17)

[0149] sgRNA4 reverse oligonucleotide: 5'-aaaccc...

Embodiment 3

[0157] Example 3 pT7-sgRNA G2 plasmid construction

[0158]The fragmented DNA containing the T7 promoter and sgRNA scaffold was synthesized by a plasmid synthesis company and ligated to the backbone vector pHSG299 by restriction enzyme digestion (EcoRI and BamHI) in sequence. After sequencing verification by a professional sequencing company, the results showed that the target plasmid: pT7-sgRNAG2 plasmid was obtained See atlas figure 2 .

[0159] Fragment DNA containing T7 promoter and sgRNA scaffold (SEQ ID NO: 23):

[0160] 5'-gaattctaatacgactcactatagggggtcttcgagaagacctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttaaaggatcc-3'

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a preparation method of non-human animals or offspring thereof genetically modified by an Hr gene. The non-human animals or offspring thereof prepared by the method do not express HR proteins in vivo or expressed HR proteins have no function, and a hairless phenotype can be showed.

Description

technical field [0001] This application relates to the establishment method and application of a genetically modified animal model, in particular, to a construction method based on a Hr gene function-deficit animal model and its application in biomedical research. Background technique [0002] The physiological process of mice is similar to that of humans, and 98% of the genome is homologous to humans. Many mouse disease models can basically simulate the pathogenesis of human diseases and their responses to drugs. Therefore, various humanized immunodeficiency mice It has become a routine and important research tool in the medical field, especially in the process of tumor research. [0003] The currently recognized mouse model with the highest degree of immunodeficiency is NOD SCID Il2rg- / - mice, including NSG of the Jackson Laboratory in the United States, NOG of the Central Institute for Experimental Animals in Japan, Shenzhen NSI from Vivo Biomedical Technology Co., Ltd. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/90C12N5/10A01K67/027A01K49/00
CPCA01K67/0276A01K2207/15A01K2217/075A01K2227/105A01K2267/0331A61K49/0008C07K14/47C12N15/113C12N15/907C12N2310/10C12N2510/00C12N2310/20
Inventor 沈月雷白阳黄蕤尚诚彰张美玲姚佳维郭朝设郭雅南
Owner BIOCYTOGEN JIANGSU CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap