Identification method for identifying PGC transplantation offspring chickens by feather color in combination with molecular genetic markers

A technology combining molecular and genetic markers, applied in the determination/inspection of microorganisms, biochemical equipment and methods, animal husbandry, etc., can solve the problems that are difficult to apply, and achieve the effects of strong feasibility, accurate identification, and low cost

Pending Publication Date: 2019-09-27
YANGZHOU UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In mammals, germplasm resources can be preserved by combining sperm or egg embryo freezing technology with single s

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification method for identifying PGC transplantation offspring chickens by feather color in combination with molecular genetic markers
  • Identification method for identifying PGC transplantation offspring chickens by feather color in combination with molecular genetic markers

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0007] The raw materials required in the present invention are: the chicken embryo of the wolf pheasant hatched to 4.5 days, and the embryo of the recessive white-feather chicken hatched to 2.5 days. Gold Mix (Qingke), genome extraction kit (Tiangen), LEI094 PCR amplification primers: upstream CAGGATGGCTGTTATGCTTCCA, downstream GACCATACTTCTGGAACAAG.

[0008] Culture medium: 43.5ml KO-DMEM medium, 5% FBS (volume concentration), 1% chicken serum (volume concentration), 1% penicillin (volume concentration), 0.4% non-essential amino acids (volume concentration), 0.2 μl β-mercaptoethanol, 100 μl hSCF (5ng / ml), 100 μl bfgf (10 ng / ml), 50 μl LIF.

[0009] A method for identifying PGC transplanted offspring chickens through feather color combined with molecular genetic markers, the specific methods are as follows:

[0010] (1) Under a stereomicroscope, separate the genital ridges of Langshan chicken embryos hatched for 4.5 days, digest with trypsin for 3 minutes, add culture medium t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an identification method for identifying PGC transplantation offspring chickens through feather color in combination with molecular genetic markers, and belongs to the technical field of biology. In order to solve the identification problem of PGC transplantation offspring, the genetic source of the offspring chickens is successfully identified by adopting an offspring chicken feather color and microsatellite marker analysis method. The identification method is suitable for protection and species restoration of germplasm resources of poultry, and has high feasibility, accurate identification and low cost. The genetic composition of the offspring chickens can be effectively identified, and technical support is provided for production of gene editing model chickens.

Description

technical field [0001] The invention relates to a novel identification method for identifying PGC-transplanted offspring chickens through feather color combined with molecular genetic markers, and belongs to the field of biotechnology. Background technique [0002] In mammals, germplasm resources can be preserved through sperm or egg embryo freezing technology combined with single sperm injection technology, but due to the characteristics of birds laying eggs, this method is difficult to apply in birds. Due to the characteristics of egg-laying chickens, it is the main method to produce offspring of donor cells to prepare reproductive chimeric chickens by transplanting PGCs in 2.5-day-old chick embryo blood vessels. Contents of the invention [0003] The present invention aims to overcome the identification problem of offspring produced after PGC blood vessel transplantation, and invents an intuitive and accurate identification method for chicken PGC transplanted offspring,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6869A01K67/027
CPCC12Q1/6869A01K67/0271A01K2207/12A01K2227/30A01K2267/00C12Q2531/113
Inventor 左其生金晶李碧春赵瑞丰李婷婷袁霞靳锴
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap